Soll Gott von der Schule fliegen?

Wie Religion in der Schule vermitteln? Vielleicht mit «The life of Brian» der Komikertruppe Monty Python. «Ihr seid alles Individuen», sagt der falsche Brian in dieser Szene zum Meer seiner Anhänger. Ein einziger streckt die Hand auf und sagt: «Nein, ich nicht!»

Wie Religion in der Schule vermitteln? Vielleicht mit «The Life of Brian» der Komikertruppe Monty Python. «Ihr seid alles Individuen», sagt der falsche Brian in dieser Szene zum Meer seiner Anhänger. Ein Einziger streckt die Hand auf und sagt: «Nein, ich nicht!»

Jüngst kam es bei uns zu Hause zum Religion-Kultur-Clash. Die Kinder wollten eine Harry-Potter-DVD schauen, ich erlaubte es ihnen, musste aber einräumen, dass ich nicht wisse, ob das DVD-Laufwerk auf dem Computer noch funktioniere. Und ob wir die DVD denn überhaupt hätten, fragte ich. Der Sohn war von der Aussicht, Harry Potter schauen zu dürfen, elektrisiert. «Ok, Mama, du schaust nach, ob es mit dem Computer geht», sagte er zu mir, «du suchst den Film», wandte er sich an die Schwester, «und ich bete.» Beten? Mein Sohn, der sonst gerne verkündet, dass er nicht an Gott, sondern an den Urknall glaube? «Ich dachte, du glaubst nicht an Gott?», sagte ich. «Ach weisst du, falls es doch einen Gott geben sollte, kann es nicht schaden», sagte er.

In den Augen der Freidenker hätte ich meinen Sohn wohl ins Gebet nehmen müssen. Oder zumindest vermuten, dass er in der Schule indoktriniert worden war. Dies jedenfalls sind die Sorgen, welche Freidenker im Raum Zürich umtreiben. Stein des Anstosses ist das Schulfach «Religion und Kultur». Eingeführt vor zwei Jahren als Ersatz für den zuvor abgeschafften Religionsunterricht, soll das Fach das Verständnis für religiöse Traditionen und Überzeugungen fördern. «Erkenntnis statt Bekenntnis» lautet das Motto des Fachs, dennoch befürchten Freidenker, dass ihre Kinder dort vornehmlich religiöse Positionen und Toleranz vermittelt bekommen, während agnostische Positionen zu negativ dargestellt werden. «Mogelpackung Religion und Kultur», so nannte ein Vater aus Hombrechtikon jüngst den Unterricht und drohte mit Boykott.

Eine extreme Position, die zunächst vor allem für eines spricht: dass die Fronten sich hier wie in vielen anderen Bereichen des Zusammenlebens verhärten. Aber ist sie auch berechtigt? Die Argumente der Freidenker sind zunächst zwar einleuchtend. Europa sei zwar durch die Schule der Aufklärung gegangen und heute weitgehend säkularisiert, doch weltweit gebe es eben auch die komplementäre Tendenz zur Verschärfung der religiösen Bekenntnisse. Tatsächlich gewinnt ja religiöser Fundamentalismus nicht nur in der islamischen Welt an Boden. Dem nur mit dem typisch europäischen kulturellen Relativismus und Ironie zu begegnen sei gefährlich. Und deshalb müsse man jeder Form von Religiosität konsequent aus dem Staatswesen verbannen.

Doch was heisst das nun bezogen auf ein Fach wie «Religion und Kultur»? Statt «christlicher Werte», so fordern die Freidenker, sollte in einem solchen Fach konsequente Ethik unterrichtet werden, Evolution statt Schöpfungsgeschichte, Aufklärung statt Glaube. Aber wie, so kann man sich fragen, kann Ethik begründet, Wissenschaftsgeschichte vermittelt, unsere Kultur überhaupt verstanden werden, wenn man nicht auf auf christliche Wirkungsgeschichte zurückgreift? Gründen letztlich nicht auch humanistisch-ethische Werte auf einem aufgeklärten Glauben? Und ist es nicht gerade auch die Aufgabe eines solchen Fachs aufzuzeigen, wie mächtig religiöse Vorstellungen sein können?

Ich bin absolut dafür, dass wir im Westen an der Aufklärung festhalten, säkulare Werte vertreten und religiöse Intoleranz anderer nicht tolerieren. Dies gilt insbesondere auch, was die Frage der Gleichberechtigung von Mann und Frau angeht. Ich glaube auch, dass man Kindern so früh wie möglich Philosophiegeschichte vermitteln sollte, damit sie lernen, woher wir kommen und warum wir so denken, wie wir denken. Wenn man die Gottesvorstellung mit all ihren Implikationen konsequent ausmerzt, macht das Kinder meiner Meinung nach eher anfällig dafür, sich später umso radikaler dazu bekehren zu lassen. Und deshalb ist ein Fach wie «Kultur und Religion» meiner Ansicht nach eine gute Sache, sofern dort nicht einfach nur vermittelt wird, dass es verschiedene Kulturen und Religionen gibt, sondern vor allem, wie wir dazu gekommen sind, so zu denken, und dass dies eine wichtige Errungenschaft ist, die wir auf keinen Fall preisgeben dürfen.

Dann darf der Sohn es meinetwegen auch mit Beten versuchen, wenn der Film nicht läuft.

Lesen Sie zum Thema auch: Auf dem Kreuzzug

856 Kommentare zu «Soll Gott von der Schule fliegen?»

  • Armando sagt:

    Was hat Gott an einer Schule verloren? Es gibt nicht einen Gott, sondern viele Götter: der Gott der Katholiken, jener der Protestanten, dann auch noch den der Christkatholiken, der Freikirchler, der Sekten, dann gibt es den Alah der Moslems, die Götter der Hindus, Buddha in verschiedenen Ausprägungen, die Animisten aus Afrika. Es gibt aber auch die Atheisten, die an keinen Gott glauben. All das muss im Religionsunterricht unter ein Dach gebracht werden, und zwar so, dass es für alle stimmt. Keine einfache Aufgabe, aber anders geht es nicht. Also Ethiklehre statt Relionsunterricht.

  • Soll Gott von der Schule fliegen? Kann er ja nicht, da es ihn vermutlich nicht gibt: …noch ein Agnostiker!
    Oder haben Sie ihn schon einmal in der Schule getroffen? Ich nicht. Seit 1945 gehe ich immer wieder zur Schule. Damals in den Kindergarten, dann in einige weitere. Dann immer wieder begleitend mit meinen Kindern. Das ist heute noch so. mein Jüngster wird in ein paar Tagen 13. In seiner Schule bin ich im Elternrat, also noch immer hautnah dabei. Aber eben, keiner der lieben Götter ist mir jemals in der Schule begegnet. Hier bei uns im Gellert finden sogar jeweils Schulveranstaltungen in der gegenüberliegenden Kirche statt. Schon komisch fand ich – aber was soll’s. Auch dort ist mir noch keiner begegnet…
    Aber ernsthaft: Ich finde den Religionsunterricht soll es in Basler Schulen schon geben. Als wirklicher Religionsunterricht, als Einblick in alle Religionen. Auch „Kirchen“ wie Scientology und andere Sekten (oder sind das nicht alles Sekten?), sollten unserem Nachwuchs genaustens von gutem Fachpersonal ganz detailiert erklärt werden. Das habe ich unserem Erziehungsdirektor Christioph Eymann schon vor Jahren erzählt! In Zürich gibt’s das schon lange. Vielleicht findet deshalb der Pfarrersohn Christoph Blocjher (SVP nicht CVP…!) Basler sei eine Bünzli-Stadt…

    • Brunhild Steiner sagt:

      Scientology ist ein raffiniert aufgebautes Wirtschaftsunternehmen mit Schwerpunkt auf „Weiterbildungskurse verkaufen“ und so nebenbei wichtige Positionen besetzen, keine Sekte, aber zu Recht beobachtungswert und aufgeklärt darüber sollte ebenfalls werden, da haben Sie vollkommen Recht.
      Dass Sie Gott so persönlich in der Schule noch nicht begegnet sind erstaunt mich nicht allzusehr, hatte er sich doch nicht mal den tapferen sowjetischen All-erkundern gezeigt…, ein bisschen publikumsscheu vielleicht?

  • Franz Oettli sagt:

    Religion gibt den Menschen halt Halt und gibt ihnen Sicherheit. Ich finde das nicht schlecht, auch uns hat es manchmal Trost gegeben, wenn jemand gestorben ist. Aber Gott habe ich selber noch nie getroffen, vielleicht sehe ich ihn ja bald, dann wissen wir’s mit Sicherheit.

  • Daniel Heierli sagt:

    „Man soll die Schule nicht zur Hure der Politik machen!“
    Diese Aussage von einem Schulpfleger passt für mich perfekt auf dieses Fach. Was soll denn über die Klinge springen? Wo reduzieren? Weiss das überhaupt schon jemand?
    Weil der Kantonsrat die Hose voll hatte vor der Volksinitiative hatte man überstürzt dieses Fach eingeführt.
    Die Behauptung, Kenntnis von anderen Religionen sei Voraussetzung für friedliches Zusammenleben, ist Unsinn. Haben sie noch nie Blogs von Islamhassern gelesen, die massenhaft Koransuren zitieren können? Zum friedlichen Zusammenleben braucht es vor allem Anstand, und zwar von beiden Seiten.
    Ich mache mir nicht Sorgen, dass die Kinder indoktriniert würden. Nein, ich befürchte vielmehr, dass in diesem Fach ganz viele langweilige, unproduktive Stunden stattfinden werden. Religion und Kultur gehörte schon immer in den Bereich des Faches „Mensch und Umwelt“. Dort sollte man es gefälligst lassen. Ohne erzwungene Stunden-Überdotierung!

  • rascha kocher sagt:

    PS: Nimmermüde können bei mir auch auf Facebook weiterspinnen…

  • rascha kocher sagt:

    Was soll das. Jeglich güldene Kälber (Chr. Blocher) oder Götzenbilder (Wort mit 4 Buchstaben) sind doch da, um eine gewisse Leere aufzufüllen. Andere machen es in der Form – wie sie zum Agnostiker mutieren. Mal abgesehen aller Relideologien (Sämtliches, das sich auf Zeilen stützt) müsste die Definition also lauten: was fehlt denen dann? Im Prinzip geht es ja nur um die Heliozentrik. Wobei selber denken nun mal anspruchsvoller als sämtlich Vorgefertigtes. Menschlich irgendwie, da zur Passivität geneigt bei all diesen unübersichtlichen Angeboten rundum. Die Logik? Alles was nicht Mainstream ist bleibt out! Und wenn dann da noch ein paar Freaks daherkommen, ungesteuerte – wird’s grad unübersichtlich, gell.
    Liebe Erde: Könntest du nicht nocheinmal von vorn beginnen mit dem Ur aller Glaubensrichtungen (der ältesten „Religion“ überhaupt), dem Sonnenkult? Besten Dank & Gruss!

  • R. Zbinden sagt:

    Dieses Thema wurde ja schon sehr breit abgehandelt, aber ich gebe hier trotzdem auch noch meinen Kommentar dazu ab;

    ich finde, dass sich nach der Befreiung durch die 68er-Generation das Pendel wieder extrem in die Gegenrichrtung bewegt hat.

    So sehen wir, dass es KEINEM Gott geben KANN, bei all dem Elend auf dieser Welt*

    Und wenn denn die Bibel wahr wäre und nicht bloss ein Märchenbuch; wo ist dann die Güte und Gnade dieses Gottes?
    War Gott nach diesem Buch nicht der 1, hartherzige und weder christlich noch sozial eingestellte Liegenschaftsbesitzer und Vermieter, welcher seine Mieter unbekleidet und ohne Nahrung auf die Strasse stellte?

    Nein, ich stelle fest, dass sich die sogenannten Freikirchen und „christlichen“ Fundis massiv breit machen, und mehr und mehr in die Gesellschaft eingreifen und diese beeinflussen. Dies geht hin bis zu einer neuen Missionierung der Gesellschaft hier in Europa, in ; der Schweiz.
    Deshalb; wehren wir den Anfängen und streben wir wieder eine freie, offene und toleratne Gesellschaft an, wo jeder nach seiner Fasson glücklich, oder unglücklich werden kann.

    Kein christlicher Fundamentalismus unter dem Segel der erzkonservativen SVP, sondern modern und weltoffen, wie z.B. die Freidenker, der Aufklärung und dem Humanismus verpflichtet.

  • Libertin sagt:

    Zoologie statt Religion, ganz im Sinne des delphischen „Erkenne dich selbst“: http://www.youtube.com/watch?v=1cZ-SNht5DA&feature=fvw

  • Friedrich Dürrenmatt hat einmal in Stoffe IV bis IX eine atemberaubende Kurzgeschichte über das Nichts und das Sein geschrieben:

    http://www.euse.de/lost/hirn/

    Bis heute unübertroffen!

  • tobe or not tobe sagt:

    @Andreas H.: “ Aber bei der heutigen wirtschaftlichen Lage wollen gewisse Kräfte lieber günstige Arbeitskräfte welche sich möglichst schnell in der Wirtschaft abarbeiten “

    Deshalb schickt man ja seine Kinder zum Wirtschaftsstudium. Das kling gut und kling nach $$$!

    Man benötigt heute nur noch Maschinenmenschen, die nicht denken, nicht kritisieren, nicht hinterfragen und alles mitmachen, was die wirtschaft vorgibt. Deshalb werden wir immer wieder skrupellose Bänkler und Börsenplayers heranzüchten. Prinzipien wären in jedem glauben vorhanden, werden aber nur noch zum eigenen Vorteil genützt. Verzichten ist nicht die Stärke dieser Gesellschaft. .

    Geisteswissenschaften sollen in die Schule gehören. Man soll über das christentum, den Islam, Buddhismus und die vielen weiteren Religionen aufgeklärt werden. Das hat uns gefehlt, und genau deshalb wird mit Vorurteilen hantiert anstatt zu wissen, was ein muslim glaubt oder wieso ein buddhist so und so handelt.

    Zensur und Unterdrückung von Information und Wissen ist eine schande an sich und passiert tagtäglich in dem kleinen Land.

  • Andreas H sagt:

    Natürlich gehört Gott an die Schulbank genauso wie Descartes, Kant und Nietzsche!

    Wir haben nur ein Problem. Wo ist noch Platz im Lehrplan um die Geistes- und Sozialwissenschaften ausführlich zu behandeln? Fürs spätere Leben sind Erkenntnisse die man aus diesen Bereichen zieht oft wertvoller und wichtiger als Rechnen, Chemie und Fremdsprachen. Aber kann man den Geistes- und Sozialwissenschaften wirklich mehr Wert geben in den Obligatorischen Schuljahren? Was soll man zurückstecken?

    Ich glaube in den 9 Jahren die wir heute zu verfügung haben hat es schlicht nicht genug Platz um Philosophie und selbst Religion den Wert zuzumessen den sie verdienen.

    Persönlich könnte ich mir vorstellen, dass er der Schweiz sehr gut tun würde ein zusätzliches obligatorisches Schuljahr anzuhängen und ein Grossteil der gewonnenen Lektion im Bereich der Geistes- und Sozialwissenschaften anzusiedeln (das ganze natürlich verteilt über die dann wohl 4 Jahre Oberstufe).

    Aber bei der heutigen wirtschaftlichen Lage wollen gewisse Kräfte lieber günstige Arbeitskräfte welche sich möglichst schnell in der Wirtschaft abarbeiten. Zu viel wissen ist schädlich. Rechnen und Deutsch, das reicht um ein produktiver Bürger zu sein 😉

    • Globetrotterin sagt:

      Womit die Patriarchatsverteidiger mal wieder das letzte Wort haben. Puhh! Jetzt haben sie uns aber wieder mal gezeigt, wo de Bartli de Moscht holt!

      • tobe or not tobe sagt:

        Mein Kommentar ist wohl verschwunden.

        Egal.

        anz klar hat Gott nichts zu suchen in der Schule, sollte aber thematisiert werden als Freifach und nicht als obligatiorisches Fach. Mann kann seine Augen auch nicht ganz schliesse. Ich als Nichtchrist fordere Toleranz gegenüber nichtgläubigen und Religionslosen, somit muss ich auch Toleranz gegenüber Gläubigen zeigen können. Wir müssen uns also in der Mitte treffen. Doch ich bezweifle, dass das im Sinner der Kirchen ist, die ihre Arme bis ins Bundeshaus hat. Kirchenlobbyisten sind noch immer weit verbreitet.!

        Daher kein Gott an der Schule und kein Gott in der Politik!! CVP schreibt sich christliche Werte auf die Fahne, also ist es eine Religionspartei, ergo gehört sie meiner Meinung nach abgeschafft .

        Viele Leute haben Ansgt davor den Glauben loszulassen und ihrem Verstand nachzugeben, der ihnen schon seit Ewigkeiten sagt, das es nur Märchen sind.

    • Franz Oettli sagt:

      Mein Chef hat immer gesagt: Der Glaube kann zwar Berge versetzen, wir bevorzugen heutzutage aber Dynamit!

  • Bemerkenswert ist eigentlich nur die Tatsache, dass in sämtlichen Weltregionen, auf allen Kontinenten und in allen Kulturen schon immer so etwas wie Glaube existiert hat, auch vor dem Zeitalter der überwiegend monotheistischen Religionen, die sich selber natürlich immer als das einzig Wahre verstehen. Wahrscheinlich sind und waren das alles Vollidioten, die ihrer Ur-Angst vor dem Nichts lediglich zu viel Raum gelassen haben. Doch als überzeugter Agnostiker kann ich das eigentlich gar nicht richtig beurteilen.

    Und damit ist mir ehrlich gestanden sauwohl! Solange das Nichts nichtet, kann genau genommen gar nichts schief laufen- selbst wenn es für einmal nicht nichten sollte 🙂

    • tobe or not tobe sagt:

      Kann Ihre Meinung teilen. Religion war in den dunklen Zeiten ein notwendiges Übel um den Mensch zu zivilisieren und von seinen tierischen Bedürfnissen abzulenken.

      Das gute was Religionen mit sich bringen, sind die schlichten Regeln des Zusammenlebens. Ob im Islam Christentum etc..

      Doch in meinen Augen sind das Regeln die uns klar sein sollten, die eigentlich jedes Kind weis bevor es überhaubt eine Ahnung davon hat. Daher habe ich mehr Mühe mit Kirchen und nicht den Gläubigen. Doch die Gläubigen machen die Kirche aus, deshalb war das für mich mitunter ein Grund zmu Austritt und Emanzipation von christlichen „Grundwerten“. Grundwerte die uns eingehämmert wurden und trotzdem niemand lebt.

      Man ist nächstenlieb um profit zu ergattern, sein Ego zu pollieren…

    • Til sagt:

      Kann man überhaupt überzeugter Agnostiker sein?

  • Logine sagt:

    Ich vermute fast, dass die Episode ums betende Kind konstruiert ist und wohl nie so stattgefunden hat.

    Dass sich damit über 700fachen Verkehr auf der Seite generieren lässt grenzt doch tatsächlich an ein Wunder und wird die Werbeabteilung frohlocken lassen. 😉

  • heidi reiff sagt:

    @ Globetrotterin

    Ich schätze Ihre Ihre gradlinige Haltung hier im Blog

    @ alle

    In der Aussage von Karl Marx „Religion ist Opium für das Volk“ steckt ein Funken Wahrheit. Bekannt ist ja, dass die grössten Verbrechen an der Menschheit durch RELIGIONSFANATISMUS gekoppelt mit ERZIEHUNGSFANATISMUS geschehen ist . Steinigungen AUS FANATISCHEM KULTURFANATISMUS. Menschen die ausgepeitscht werden öffentlich, KLITORIS BESCHNEIDUNG , AUS DER JUDENECKE VORHAUTBESCHNEIDUNG BEI MAENNLICHEN BABYS, IN DER USA OFT AUCH UNSCHULDIGE MENSCHEN DIE JAHRELANG IN GEFAENGNISSEN DARBEN, DIE STRAFE IST DANN DER ELEKTRISCHE STUHL. In Amerika ist längst nicht alles Gold was glänzt, diese aufgeplusterten Politiker- und Politikerinnen haben weltweit nicht alles im Griff, diese Macht- und Gottspielerei ist FATAL, INKL. GELDGIER. Ich habe Verständnis, dass Frauen in Burkas in der CH nicht geduldet werden in Burkas, Kinder die nicht teilnehmen dürfen in der Schule am Schwimmunterricht aus RELIGIONSFANATISMUS.

    Vor Jahren hab ich mal einen Film gesehen von Güther Grass – die Blechtrommel – der Film hat aufgedeckt – nicht zugedeckt.

    Greenpeace finde ich eine gute Sache, ich weiss ja nicht ob der Vatikan da noch mitmischelt, ist vielleicht ein Trostpflaster oder Rettungsanker für unsere Todesangst die bei mir auch mitläuft. So werden wir gegängelt um uns klein zu halten. Wo ist unser Anteil als erwachsene Menschen ?

  • auchVater sagt:

    zuviel. alle kommentare sind mir zuviel. habe mir ein paar ausgesucht. die von globetrotterin sind mir (schon) wieder positiv ins auge gestochen.
    hmm…
    aber vielleicht habe ich ja nicht alle gefunden.
    🙂

    zum thema:
    auffallend ist: religionen sind männerzeugs.
    weibliche priester, führer, gurus sind sehr selten und wenn, dann oft in irgendein pantheon-gesamtbild eingefügt.
    es ist offensichtlich. religionen sind von männern konstruiert, männer kommen darin als hauptdarsteller mehrheitlich vor und männer sind die massgebenden, wenn es um die anwendung von riten, kultischen handlungen etc. geht.

    das heisst nicht, dass nicht frauen dahinter stecken (können).
    siehe auch meinen post zum (kein) sex in der ehe (mehr) sujet von vorvorgestern.

    das religionskonzept dient in erster linie dazu, grössere ansammlungen (siedlungen) von menschen gefügig zu machen und zu halten (menschhaltung im sinn der tierhaltung). es ist ein führungs- und zusammenlebenskonzept.

    schliesslich besteht kein zweifel daran, dass grössere zusammenhängende gruppen von menschen (völker, nationen, rassen, christen …) in der lage sind, grössere komplexe systeme zu entwickeln und zu realisieren (bau, wirtschaftssysteme, bildungskonzepte, transportgeräte …).

    dieses potenzial gilt es (galt es) zu nutzen, ohne dass diese eng versammelten, wie kaninchen gehaltenen und redressierten menschen in ihre ursprünglichen emotionen, triebe etc. zurückfallen.
    essen, wenn sie hunger haben,
    schlafen, wenn sie müde sind,
    ficken, wenn giigerig sind etc.

    vielerorts haben das religionen ganz gut hingekriegt. wir würden – ohne religionen – möglicherweise noch leben, wie in sippen lebende urmenschen.

    religionen, kulte, heilige priester, gottkönige, machtbewusste klardenker und subordinierende willfährige haben die entwicklung des menschen erst möglich gemacht. ohne das gänzlich erfundene zeugs von gott und göttern, liebenden und zürnenden mächten im himmel oder in der hölle, auf bergspitzen oder in talschlünden, gäbe es keine herden und keine guten (oft auch schlechte) hirten.

    alle heutigen (und zukünftigen) errungenschaften wären vielleicht nicht (vielleicht nicht so, vielleicht in anderer reihenfolge) erfunden worden.

    der glaube an gott (an einen gott, an eine gruppe götter usw.) ist eine fundamentale menschliche erfindung.
    kein tier glaubt sowas. wozu auch?

    der glaube an mögliche bestrafung, an mögliche aufnahme im ewig währenden paradies (der glaube an das ewige sein), und an das ganze brimborium ist absolut zentral für die geschichte der menschheit – die krone der schöpfung (!!).

    vielleicht könnte es ja aufgabe einer aufgeklärten schule sein, den kindern mitzugeben, dass sie sich solche gedanken überhaupt erlauben. dass es erlaubt ist, anders zu denken als es geschrieben steht. (die heilige schrift. das heilige buch …)

    sie zu befähigen, selber zu denken.
    über gott und die welt.
    so wie sie uns gefällt.
    oder wie sie von einfluss- und anderen reichen gestaltet wird.
    wo ihr wille geschehen ist und noch geschieht.
    wo mächtige männer nur so mächtig sind, wie ihnen ihre partnerin einen orgasmus zugesteht.
    (ok, das geht zu weit, das ist für kinder noch unverständlich. aber gut, wenn man als erwachsener etwas über die ökonomie der liebe und der triebe bescheid weiss).

    dann kann man ja, so sehe ich das auch, immer noch selbst entscheiden, ob man an einen gott und das damit verbundene wertesystem glauben will.

    • fufi sagt:

      Grüsse von Uriella und den vielen selbsternannten KMU-Heilsbringerinnen mit nur rund 20 JüngerInnen/SklavInnen!
      🙁

      • auchVater sagt:

        verstehe nicht, was du mir sagen willst, herr pfarrer.

      • fufi sagt:

        RELIGIONEN mögen Männerzeugs sein. (Sind es zwar nicht, aber ….)
        Aber die vielen Menschen, die von Esoterikerinnen und selbsternannten Heilsbringerinnen – eben.
        Und DAS ist KEIN Männerzeugs!

      • auchVater sagt:

        ach. jetzt verstehe ich.
        aber so ganz weltumspannend und mit eigenen banken und anderen wirtschaftszweigen erfolgreich sind sie ja nicht wirklich, die von dir so bezeichneten kmu-heilsbringer.

        bist du übrigens als pfarrer tätig?
        oder studierter theologe, aber weltlich angestellt?
        wie wurdest du gläubig?
        wie entstand „dein“ glaube an „deinen“ gott?
        erinnerst du dich an die ursprünge?

        interessiert mich im kontext meines oben beschriebenen freiheitlichen bilds der menschlichen existenz.

      • fufi sagt:

        @ auchVater

        Also zumindest DIE PARTEI sagt, die KMU’s seien wichtig und scho fasch heilig!

        Bin NICHT als Pfarrer tätig, glaube nämlich – habe das auch schon mehrfach hören müssen – dass die lieben Schäflein vor SO einem Hirten Angst haben könnten. Weiss allerdings bis heute nicht weshalb! Aslo Brotverdienst ist weltlich!
        Wurde NICHT gläubig, Gott hat mich gerufen! Und nach Abzug der 99.9999999% psychosozialen Faktoren/Umständen/Wasauchimmer blieb dennoch ein klitzekleines Restrisiko, was ich dann eben auf mich genommen habe!
        😀

    • Globetrotterin sagt:

      @auchVater:
      Wie schön zu wissen, dass es da noch mehr Verbündete gibt. Ein Satz in ihrem Beitrag ist bei mir hängen geblieben:
      „wir würden – ohne religionen – möglicherweise noch leben, wie in sippen lebende urmenschen.“ Sind – oder haben wir es – heute wirklich soviel besser? Manchmal neige ich dazu, daran zu zweifeln.

      Und noch eine kleine Gute-Nacht-Geschichte:

      Ein Atheist ist gestorben. Er kommt in einen langen dunklen Gang, an dessen Ende er ein Licht brennen sieht. Er geht darauf zu und findet eine Tür mit einem Schild „Eingang zur Hölle“. Erst zögert er, dann öffnet er die Türe einen Spalt breit um hinein zu sehen. Er kann kaum glauben, was er sieht: Strahlende Sonne, Palmenhain, weisser Sandstrand, weites, türkisfarbenes Meer. Er geht hinein, spaziert am Strand entlang und kommt zu einem Liegestuhl, auf dem ein seltsames Wesen mit Schwanz und Hörnern liegt. Der Atheist sagt „Du musst wohl der Teufel sein.“ – „Ja, der bin ich. Willkommen in der Hölle. Da hinten ist eine Bar. Hol‘ Dir doch einen kühlen Drink und setz‘ Dich zu mir, damit wir ein bisschen plaudern können.“ – Der Atheist geht in Richtung Bar. Plötzlich kommt er an ein riesiges Loch, aus dem Flammen schlagen. Er schaut hinunter und sieht das Grauen vor sich. Das Loch ist voller menschlicher Körper, die im Feuer schmoren. Entsetzt rennt er zum Teufel zurück und fragt, völlig ausser Atem: „Was ist denn DAS dahinten? Das ist ja grauenvoll!“ – Der Teufel: „Ach, das Loch dahinten meinst Du? Beruhige Dich, das haben wir nur für die Juden und Christen gemacht. Die wollen das so!“

      • tobe or not tobe sagt:

        🙂 Habs doch gedacht, die Hölle wird gemütlich und der Himmel stinklangweilig .-)

      • fufi sagt:

        @Globe

        Also wenn ich den Witz richtig verdrehe, heiss(!)t das, dass Atheisten zwar nicht an Gott glauben, aber schon an den Teufel?
        Kann ich verstehen, nennen sich ja auch nicht Adiaboliker – oder so.
        Dennoch bring ichs in meinem Kleinhirn nicht so richtig auf die Reihe!
        Hol’s der Deibel!
        😀

        Und nochwas: Kompliment für deine politische Korrektness, indem du nur Juden und Christen erwähnt hast!
        😛

  • Das Einhorn sagt:

    Der Bl0g als schwarzes Loch: Man schmeisst was rein und weg ist es.

  • interim placeholder sagt:

    Niemand hat den Satz „In den Augen der Freidenker hätte ich meinen Sohn wohl ins Gebet nehmen müssen.“ gelobt. Fabelhaft, wegen solcher kleinen Falltüren liebe ich Ihre Texte, Michèle.

    „[..] dass die Fronten sich hier wie in vielen anderen Bereichen des Zusammenlebens verhärten.“ So ist es. Wer hier einen Blick in die hässige, fast schon militante Diskussion um den Waffenartikel gelesen hat sowie die Diskussion um die Fehr-Albisgütli-Attacke auf Blickonline, kann zu keinem anderen Schluss kommen.

    • interim placeholder sagt:

      wegen solcher kleineR Falltüren. Sorry für die faltsche Grammatik.

    • Libertin sagt:

      Ja, hätte sie. Wenn der Sohnemann gesagt hätte, jetzt mache ich mal eine voodoo-Beschwörung mit der Fernbedienung wäre sie ja auch nicht einfach zur Tagesordnung übergegangen.

      Liess sie denn den Sohn gewähren, weil sie ihn ernst nimmt? Oder war das „dann mach mal“ eher oberflächlich-gönnerhaft? Humoristisch? Wieso nimmt sie den Kleinen nicht ernst und betet mit? Alle? Da hätte man ein für allemal die Wirksamkeit des Gebetes im Feldversuch testen können.

      Aber man will ja weltmännisch tolerant und pluralistisch sein, vergesst dabei aber das Risiko

      ….wer für alles offen ist ist nicht ganz dicht.

      • interim placeholder sagt:

        Ich bin Freidenker, und als solcher verlange ich, dass die Schulen das Freidenken unterrichten, denn diese ewige Toleranz geht mir auf den Ssssack aber sowas von.

      • Auguste sagt:

        hmm…, freidenker machen eigentlich auch nichts anderes als andere die ihr gehirn benutzen – sie tun’s einfach nur lauter.

      • fufi sagt:

        @ interim placeholder

        SUPER Idee!
        1. Stunde: Lehrer(in) sagt: ES GIBT KEINEN GOTT! – Kevin und Sabrina fragen gleichzeitig: WER ist Gott!
        Holy shit!
        🙁

      • Auguste sagt:

        hmm…, nein orlando, sind sind einfach wieder nur laut – ganz ohne die erwähnte prämisse.

      • Orlando S. sagt:

        @Auguste: sie sehen mich schon an Orten, wo ich gar nicht bin, man nennt das Halluzinationen. hmm…lassen sie sich helfen. Vielleicht gibts im „Paralleluniversum“ ja noch eine Wand, wo sie Druck ablasen können, wenn sie wissen was ich meine.

  • Libertin sagt:

    Eben, weshalb soll aus nichts nicht etwas sein. Der Urknall erklärt sich aus den bekannten Naturgesetzen, ebenso das Leben. Dass es entstand ist wundersam. Aber kein unerklärbares und schon gar kein „göttliches“ Wunder. Wir sind in unserer Sprache gefangen. Nur, weil es Worte für irgendwas gibt es dieses Etwas nicht zwangsläufig. Und nur, weil wir irgendeine Frage stellen können heisst das nicht, dass die Frage sinnig ist oder gar eine Antwort darauf nötig oder „richtig“ sei.

    • Eremit sagt:

      Das ist wohl eine Frage des Charakters.

      Aus Nichts kann nichts werden.

    • fufi sagt:

      @Libertin

      „Der Urknall erklärt sich aus den bekannten Naturgesetzen, ebenso das Leben.“
      Leider ist’s eben gerade NICHT so!

      Mit den BEKANNTEN Naturgesetzen lässt sich die Geschichte des Universums nur bis zum
      Zeitpunkt 10 hoch-43Sekunden NACH dem Urknall erklären (sogenannte PLANCK-Zeit).
      ALLES vorherige bleibt im „Quantenschaum“ verborgen!, auch wenn sie sagen, dass damals die „Quantengravitation“ geherrscht haben soll. DAVON versteht nämlich – zumindest heute – niemand grad schon gar nichts!

      DAs LEBEN lässt sich nämli ebensowenig erklären. Nur schon deswegen, weil auch heute noch keine allgemein anerkannte Definition dessen vorliegt, was Leben eigentlich sein soll! Stoffwechsel? – da lachen sich die Viren krank! Vermehrung? Ich teile mich also bin ich? Weitergabe der Gene? da fragen sich gewisse Bakterien aber schon, ob sie auch künftig noch Gensequenzen aus der Umwelt aufnehmen und in ihr eigenes Genom einbauen dürfen?

      Unsere „Naturgesetzte“ erklären sehr vieles „Nachheriges“. Aber NUR das!

  • Anh Toan sagt:

    @mila: und apropos Absolutheit der eigenen Meinung: Ich war immer ueberzeugt, dass das Schlimmste auf der Welt eigentlich Zuhaelter sind. Wie kann man von Maedchen leben, die nichts als ihren Koerper zu verkaufen haben? Prostituierte haben mich belehrt, dass die Mehrheit der Zuhaelter nichts als nuetzliche Dienstleister sind. Soviel zur Absolutheit von Meinungen.

    • mila sagt:

      mir ging es mit vielen dingen so, weshalb ich heute mit meinen ansichten sehr viel vorsichtiger bin. ja, es wird einige frauen geben, die ihren körper auf freiwilliger basis gegen geld zur verfügung stellen, die vielbesungenen studentinnen, gelangweilten hausfrauen etc. daneben gibt es auch das human trafficking, das unter eine ganz andere kategorie fällt. und dazwischen finden sich zahlreiche grauzonen – haben sie „im angesicht des verbrechens“ gesehen? zwei osteuropäische (volljährige) mädchen willigen darin ein, nach berlin zu kommen, um dort einem ‚anständigen‘ job nachzugehen. zumindest eine von ihnen weiss jedoch genau, dass besagter job nicht so ‚anständig‘ sein wird. aber ist ein solches schicksal wirklich als freiwillig gewählt zu betrachten, oder nicht doch von einer persönlichen (existenz-)not zumindest teilweise mitbedingt? ich weiss es nicht, ich werde deshalb auch nicht darüber urteilen.

      was mich an der absolutheit von meinungen stört ist, dass sie keinen echten meinungsaustausch ermöglichen. mit missionaren, die meinen zu wissen, wie andere ihr leben zu führen hätten, lässt sich nur schwer diskutieren.

      • interim placeholder sagt:

        Wer je sicher ist, ist mir ungeheuer. Der Zweifel ist viel wichtiger als jede Sicherheit.

      • mila sagt:

        yep, sie sprechen mir aus dem herzen.

      • Auguste sagt:

        hmm…, interim placeholder, mit dieser feststellung haben sie den quell-code der versicherungsindustrie verraten – wenn sie das mal nicht in teufel’s küche bringt.

      • Globetrotterin sagt:

        @interim placeholder:
        Ich möchte Sie wirklich nicht beleidigen. Aber Ihr oben genannter Satz „Der Zweifel ist viel wichtiger als jede Sicherheit“ ist einfach nur Unsinn. Und ich möchte hiermit vor allem auch fufi nicht zu nahe treten. Aber: Welcher theologischen Fakultät gehören Sie an?

      • Orlando S. sagt:

        haha, Globaltrottelin merkt nicht, wer das ist und erkennt selber, dass das eine Dumpfbacke sein muss, hahaha…

      • mila sagt:

        na, wenn der (indirekte) verweis auf descartes einen dummkopf ausmacht, bin ich noch so gerne dumm… 🙂

      • Orlando S. sagt:

        wie schön dass sie Dumpfbacke etwas unter die Arme greifen. Der braucht das.

      • Globetrotterin sagt:

        Auch wenn das jetzt überheblich klingen mag, aber dieser Descartes ist ein Depp, den wohl niemand mehr ernst nehmen kann. Der kann zusammen mit Orlando einen Club gründen. U.a. behauptete Descartes nämlich auch, dass Tiere nichts weiter als Maschinen wären. Offensichtlich aber hat der ja noch ganz anderen Mist gepredigt.

  • Libertin sagt:

    Wer sich die Frage warum ist etwas und nicht nichts mit „Gott“ beantwortet muss sich die Frage gefallen lassen, wieso aus etwas nichts wird? Wieso muss Leben vergehen? ….

    • fufi sagt:

      Sagen wirs doch mal so:
      Warum aus nichts etwas wird, betrifft nur die Frage des Urknalls (der Existenz des Universums)
      Und dass aus „Etwas“ „NICHTS“ werden sollte, nachdem es „ETWAS“ gibt?-NEGATIV!
      Sogar aus der „Annihilation“ von Materie und Antimaterie entsteht etwas, auch wenn das nur Energie wäre, was aber nach e=mc2 …….. eben.

      Weshalb Leben vergehen muss?

      Weshalb sollte es nicht?

    • Blitz Blank sagt:

      Zumindest nach meinem Verständnis ist es nicht möglich, dass aus ETWAS NICHTS wird oder aus NICHTS ETWAS. Beim physischen Tod ist es ja so, dass das Leben des Körpers weitergeht, was zerfällt ist die Organisation des Körpers (Zersetzung). Der sich auflösende Körper wird zur Grundlage neuer Organisationsformen des Lebens. Natürlich lässt sich Materie auch in Energie umwandeln, aber das ist eben eine Umwandlung und keine VerNICHTung. Was mit unserem ICH beim Tod passiert, wissen wir einfach nicht. Wenn aber die Annahme stimmt, das aus ETWAS nicht NICHTS werden kann, dann muss auch das ICH in irgendeiner Form weiterbestehen.

      • Globetrotterin sagt:

        @Blitz Blank:
        Und wenn das „Ich“ nur eine Illusion wäre, die uns unser Gehirn vorgaukelt?

      • Blitz Blank sagt:

        Das Gefühl des ICHS ist sicherlich zum Teil eine Konstruktion. Z.B. ist es ja so, dass wenn wir uns an unsere Vergangenheit erinnern, wir das Gefühl haben, wir hätten das erlebt. Tatsache ist aber, dass kein einzelnes Atom des Körpers, den wir z.B. vor 10 Jahren hatten/waren in unserem aktuellen Körper vorhanden ist. Ca. alle 7 Jahre sind sämtliche physische Teilchen in unserem Körper ausgetauscht. Trotzdem haben wir dieses Gefühl die/derselbe zu sein.
        Ich weiss nicht, ob das ICH nur ein Phänomen des Hirns ist oder ob es über das Hirn und somit über die Materie hinausgeht.

        Gedanken, Gefühle, Bilder,…: Ich habe keine Ahnung ob solche Informationen unabhängig von Materie bestehen können und ob auch dieses ETWAS sich nicht einfach in NICHTS auflösen kann. Tröstlich wäre es natürlich.

      • fufi sagt:

        @Globe
        Dann müsste doch zumindest „unser Gehirn“ existieren – was die ganze Sache leider auch nicht wirklich vereinfacht?
        😀

      • Globetrotterin sagt:

        @fufi:
        Unser Gehirn können wir zumindest als Organ identifizieren und analysieren, was hingegen mit dem ICH realtiv schwierig werden dürfte.

      • fufi sagt:

        @ Globe
        Ist doch ganz einfach: ICH ist, was ich will?
        🙁

      • Globetrotterin sagt:

        Ich sehe das auch so, dass ETWAS nicht NICHTS werden kann. Deshalb heisst es ja: Erde zu Erde, Staub zu Staub. Damit lässt sich auch die Vorstellung von Wiedergeburt erklären. NICHTS verlässt diese Erde. Irgendwo bleiben wir alle erhalten. Sei es als Asche, Staub, Erde, Ratten-, Wurm-, Fisch- oder Vogelfutter. Wir werden ganz einfach „recycelt“.

    • Eremit sagt:

      @Libertin Warum sterben Raupen?

      • fufi sagt:

        Die wollen nämlich lieber als Schmetterlinge sterben – oder als Nachtfalter. DA haben sie sich doch wenigstens vorher noch paaren können!
        😛

      • Auguste sagt:

        @ eremit

        hmm…, weil sie von einem waschbären oder dachs gefressen werden?

  • max sagt:

    Globetrotterin, Pippi Langstrumpf, fufi und Widerspenstige sind schön brav unter sich. Wie gemütlich, trautes heim – Emanzenheim.

    Richtige Männer hängen in der Warteschlaufe.

  • fufi sagt:

    @sehr viele hier!

    Da gibts welche, die sind gegen die Religion.
    Da gibts welche, die sind für die Religion.
    Da gibts welche, die haben keine Religion.
    Da gibts welche, die sind kritisch zur Religion.
    Da gibts welche, die ……………..

    Und euch allen gemeinsam ist,
    dass ihr euch wegen der „Religion“
    zum Glück nur verbal
    gegenseitig die Birnen einschlägt.

    Eigentlich schade?

    🙁

    • tobe or not tobe sagt:

      Amen…

    • mila sagt:

      @fufi: dieses phänomen tritt wohl überall dort auf, wo einzelne von der absolutheit ihrer eigenen meinung oder persönlichen anschauung überzeugt sind. in diesem sinne würde ich mich ihnen hinsichtlich des befunds anschliessen, dass so ein bisschen erkenntnistheorie keinem schaden würde…

    • Anh Toan sagt:

      @fufi: Hab diesen Blog nur ein bisschen ueberflogen: Will man ernsthaft ueber Religion nachdenken, muss man sich fragen welches menschliche Beduerfnis Religion deckt, denn ob es Gott gibt oder nicht, koennen wir nur glauben, nie wissen. Ich glaube nicht an Gott bedeutet eigentlich das Gleiche wie ich glaube an Gott: Es drueckt Ungewissheit ueber die goettliche Existenz aus. Was bringt uns Religion. In erster Linie meine ich Stabilitaet in einer sich veraendernden und damit beaengstigenden Welt („sicher wie das Amen in der Kirche“). Ob Gott existiert ist nicht wichtig, wichtig ist, dass wir, was auch immer die Woche passiert, am Sonntag zur Messe gehen und da ist alles GLEICH: Die gleichen Rituale, Lieder, Maria bleibt Jungfrau und am Ende kommt Amen. Das ist beruhigend, gibt uns ein Gefuehl von Stabilitaet. Marx hat seinen beruehmten Satz ueber Religion gesagt, als Opium das einzig verfuegbare, wirksame Schmerzmittel war. Religion ist ein Schmerzmittel fuer die Menschen. Schmerzmittel betaueben aber eben nicht nur den Schmerz, sondern benebeln das Gehirn generell. Dies mein Vorwurf an Religion. Wenn ich andrerseits sehe, wie viele Menschen Halt in vermeintlichem Wissen (Wirtschaftsprognosen!), in Glauben an Nationen (uns Schweizern gehts immer gut), in materiellem Reichtum, oder „ewigen“ Fernsehserien (Nomen est Omen, ein Religionersatz: diese Familie bleibt mir fuer immer) suchen, frage ich mich, ob Religion nicht besser ist. Denn eins erscheint mir klar, wir Menschen kennen die Zukunft nicht und das macht Angst. Die meisten von uns koennen mit dieser Angst nicht leben. Religion ist eine ziemlich nuetzliche Droge/Medikament und befriedigt ein tatsaechlich existierendes Beduerfnis, sonst gaebe es keine Religion.

      • Globetrotterin sagt:

        @Anh Toan (Antoine?):
        Das Bedürfnis für Religion (und für vieles andere) wurde doch erst von der Religion geschaffen! Genauso, wie die Angst! Lebten wir mit dem einfachen Wissen (oder wenn Sie wollen: mit dem „Glauben“), dass wir für eine bestimmte Zeit auf dieser Erde leben und danach sterben werden, genauso wie jede Ameise, jede Maus, jeder Vogel) würden wir das so hinnehmen und wir würden vor allem unser Leben mehr geniessen. Es wäre aber sehr viel schwieriger, uns in Abhängigkeit und unter Kontrolle zu halten. Nur mit Angst sind wir manipulierbar. Wir müssen vor Allem Angst haben. Angst vor dem Leben, Angst vor dem Tod, Angst vor dem Staat, Angst vor dem Chef, Angst vor Krankheit, Angst vor …, Angst vor… fortzusetzen bis in alle Ewigkeit.

      • fufi sagt:

        @Globe

        Meine, dass sobald Menschen ein ICH-Bewusstsein entwickelt haben, auch die Angst um ebendieses ICH entstand.
        Scheint glaub verdammt schwierig zu denken/annehmen etc. sein, dass ICH irgenmal nicht mehr ist?

      • Globetrotterin sagt:

        @fufi:
        Also, für mich ist das kein Problem. Ich sehe mich nicht als so wichtig an.

      • Globetrotterin sagt:

        Warum wohl werden wir tagtäglich mit all diesen „Gesundeheits“- bzw. „Krankheits“-Sendungen im TV berieselt? Damit wird unsere Angst geschürt vor allen möglichen Krankheiten, die uns vielleicht irgendwann einmal befallen könnten. Und dann sind wir alle sofort bereit, diese astronomischen Krankenkassenbeiträge zu bezahlen! (Solche Sendungen sehe ich mir aus Prinzip nicht an.)

      • Globetrotterin sagt:

        @Anh Toan:
        Nicht zu vergessen: die Angst vor der Klimaveränderung! Die ist besonders praktisch für die Wirtschaft. Was wir uns da wieder alles neu anschaffen müssen! Da trau‘ ich mich gar nicht dran zu denken – von neuer Unterwäsche bis zum neuen Haus! Freut Euch, Ihr Börsianer. Das gibt ein tolles Wirtschaftswachstum!

    • Anh Toan sagt:

      Und philosophisch: Wenn ich mir mit jemandem verbal (gilt in gewissen Kulturen zB. England sogar fuer physisch) die Birme einschlagen kann, und wir uns dennoch gegenseitig respektieren, koennen wir eines Tages Freunde sein.

  • Widerspenstige sagt:

    Ob es einen Gott gibt, wird frühestens dann keine Frage mehr sein, wer schon ein übernatürliches Ereignis erlebt hat und davon nicht mehr loskommt. Unter übernatürlich verstehe ich eine Situation, die nach menschlichem bisherigen Denken einfach unerklärlich ist und trotzdem passiert ist während seiner Anwesenheit. Es gibt genügend Beispiele von Menschen, die darüber berichtet haben; es gibt immer wieder Dok-Sendungen darüber, es gibt die Scheintoten, die immer dasselbe erzählen von dieser Leichtigkeit und Schwerelosigkeit während sie einem wundervollen Licht entgegen schwebten und eigentlich enttäuscht waren, wieder zurück hier zu sein und davon nicht mehr loskommen….Alles nur Phantasiegeschichten und wenn ja, wozu?!

    Ich bin ebenfalls überzeugt, dass es eine spirituelle Macht gibt, die Jenseits unseres Denkvermögens liegt und ich gehe soweit, nicht einen Gott oder eine Göttin darin zu sehen, sondern ein ES – DAS SPIRITUELLE und UNFASSBARE. Einige haben es bereits angedeutet – leider nicht alle Kommentare gelesen – dass wir nur ganz mikrige Staubkörner sind in diesem unermesslichen Universum und deshalb wirklich noch fast nichts über Zwischenwelten wissen. Nicht umsonst gibt es sehr sensitive Menschen, die dieses faszinierend Spirituelle in sich spüren und sich in absolute Stille zurück ziehen. Sei es, um zu meditieren, sei es, um innere Ruhe zu finden und dem weltlichen Tun entsagen wollen. Wer darin Zufriedenheit findet, soll es doch einfach tun dürfen.

    Deshalb meine klare Antwort zur Frage des Leitartikels: Soll Gott von der Schule fliegen?

    Nein! Denn ohne elementare Kenntnis über Gott und andere Religionen bzw. Lebensphilosophien (wie sie z.B. der Buddhismus lehrt) – das wäre auch eine Diskussion wert, wo liegt der Unterschied zwischen Religion und Lebensphilosophie? – kann ein wissensdurstiges Kind nicht von der Grundschule entlassen werden. Es wächst in einer bestimmten Kultur auf und würde so über nicht genügend Wissen seiner möglichen Herkunft verfügen. Es ist mMn geradezu anmassend und unverantwortlich, sie dem Schicksal zu überlassen und die Existenz einer spirituellen Macht zu verleugnen.

    Jeder Mensch sucht irgendwann während seines Lebens nach seinem Warum-bin-ich-geboren-worden und will darauf eine verlässliche Antwort erhalten. Wer soll sie ihm geben, wenn nicht Dokumente, Schriften, etc. die einigermassen seriös recherchiert dieses Wissen wiedergeben? Dass Textpassagen in der Bibel mehrfach vom jeweiligen Übersetzer (ja, es waren immer Männer am Werk beteiligt!) eigenmächtig umgeschrieben wurden, oder falsch interpretiert (z.B. Latein ins Griechische übersetzt eine andere Bedeutung hat wie @fufi erklärt etc). bezweifle ich hier nicht.

    Es geht mir aber jetzt nicht nur um dieses Vergehen in der christlich geprägten Menschheitsgeschichte, sondern um den Begriff GOTT. Nur das Elternhaus allein kann dieses Wissen nicht elementar vermitteln, wie die Beispiele von vielen Kommentaren hier sehr schön zeigen. Ein Kind ist kein Eigentum der Eltern und darf deshalb nicht für eigennützige Zwecke missbraucht werden. Ihm existentielles Wissen vorzuenthalten aus eigenem Unvermögen die Zusammenhänge zu verstehen oder verstehen zu wollen ist unakzeptabel nach meiner Meinung. Wenn es volljährig ist, darf es frei entscheiden. Schön. Aber woher soll es plötzlich wissen, WIE es sich entscheiden soll?

    • Globetrotterin sagt:

      @Widerspenstige:
      Ich will Sie weder belehren noch Ihnen Ihren Glauben an was auch immer nehmen. In Einem aber muss ich ganz entschieden widersprechen: Die Antwort auf die Frage „Soll Gott von der Schule fliegen“ muss ganz eindeutig JA heissen. Religionsfreiheit beinhaltet nämlich auch so etwas wie Freiheit von Religion. Was Sie privat denken, glauben, beten, etc. geht weder mich noch sonst jemanden etwas an. Wenn das aber zur Allgemeingültigkeit erhoben und Kindern in einem dafür sehr empfänglichen Stadium eingeimpft werden soll, dann wehre ich mich dagegen, mit allen mir zur Verfügung stehenden Mitteln.

      • Widerspenstige sagt:

        @Globetrotterin (ja, eine echte Weltbürgerin, oder?)

        Ich habe erwartet, dass zumindest Sie mir widersprechen werden. 😉 So mag ich eine Diskussion, weil sie mit Herzblut geführt wird und mit Überzeugungskraft. Und ich gehe mit vielen Punkten die Sie beschrieben haben einig.

        Aaaber, ja jetzt kommt das grosse ABER: ich bin in einem äusserst streng-katholischen Umfeld aufgewachsen, habe sämtliche Rituale, sonntäglichen Pflicht-Kirchenbesuche etc. mitgemacht und bin deshalb geprägt davon. Dann lernte ich durch meine Partnerschaft mit einem Buddhisten das schiere Gegenteil von Religionsausübung wie ich es bisher kannte kennen und geriet zusehends in Erklärungsnotstand meiner indoktrinierten christlichen Glaubensrichtung entsprechend. Ich begann zu hinterfragen, wo sich die beiden Religionen treffen und wo sie sich absolut gegenseitig beissen. Diese ziemlich heftige Diskrepanz in den Glaubenslehren hat mir aber die Augen geöffnet für die Wichtigkeit der Wurzeln eines Glaubens an eine höhere spirituelle Macht.

        Denn wie konnte ich meinen Kindern sonst vermitteln, wieso sie geboren worden sind und all ihre wissensdurstigen Fragen einigermassen elementar vermitteln? Da war ich echt froh darum, dass es den Religionsunterricht mit allen damit zusammenhängenden Pflichten gab und vermittelte ihnen Zuhause via ihren Papa die buddhistische Seite. So wurden sie früh mit zwei verschiedenen Kulturen und Religionen konfrontiert und können sich inzwischen frei entscheiden, welche ihnen besser zusagt. Sie sind völlig frei in ihrer Entscheidung und kennen das Grundprinzip: tue nichts deinem Nächsten, was du nicht willst, dass es dir getan wird und Love and Peace!

        Eigentlich verstehe ich unter Religionsfreiheit auch dasselbe wie Sie, Globetrotterin. Aber als verantwortungsbewusste Mutter fühlte ich mich einfach verpflichtet, ihnen die Wurzeln unseres westlichen Glaubens näher zu bringen und sie nicht unnötig auszuschliessen. Denn geschadet hat ihnen diese ‚Indoktrination‘ bisher nicht wie ich das beurteilen kann – ganz im Gegenteil. Sie können mitdiskutieren und haben eine Basis sprich Urgefühl ihrer Existenz erhalten und fühlen so festen Boden unter den Füssen wenn Schwierigkeiten in ihr Leben treten. Das ist jetzt rein subjektiv erzählt, aber doch auf sehr viele andere Familien mit zwei verschiedenen Kulturen/Religionen übertragbar.

        Es ist einfacher, und das sage ich ohne jegliche Polemik, aus der Perspektive einer Kinderfreien zu diskutieren als mit fragenden Kinderaugen umzugehen – tagtäglich. Es ist ein Wunschtraum – nein, was sage ich da – ein Idealismus sondergleichen, ohne Gesetze und Regeln und Religionen als WeltbürgerIn zu leben. Die grosse Masse BRAUCHT diese Regeln, sonst würden wir sehr schnell in Anarchie leben. Denn Wenige sind auserwählt, Gutes zu tun oder so ähnlich. Ich betone, dass ich auch sehr sehr gerne ein JA zur Frage des Leitartikels hinlegen möchte. Aber die Menschheit ist einfach noch nicht soweit, Grenzen niederzureissen und als FREIE WELTBÜRGER miteinander umzugehen. Leider.

      • Globetrotterin sagt:

        Sorry, Widerspenstige, ich habe Ihren Artikel erst jetzt gefunden und muss mich noch damit beschäftigen. Aber ich antworte bestimmt, nur wird’s noch ein bisschen dauern. Für den Moment: „WAS DU NICHT WILLST, DAS MAN DIR TU‘, DAS FÜG AUCH KEINEM ANDERN ZU!“ – Mehr Religion brauche ich nicht. Und wenn das Bedürfnis nach Religion den Menschen – und vor allem den Kindern – nicht systematisch eingetrichtert würde, bräuchte kein Mensch mehr. Davon bin ich überzeugt. Auch diese elende „SINNfrage“ ist ein religiöses Konstrukt, das uns immer wieder eingehämmert wird und uns von der Notwendigkeit der Religion überzeugen soll. Der einzige Sinn des Lebens ist, es zu geniessen. Alles andere ist „Chabis“. der uns eingeredet wird.(Jetzt muss ich leider in die Küche, melde mich später nochmal.)

      • Laura TI sagt:

        Grossartig geschrieben Widerspenstige, auch wenn ich selber bekennende Christin bin, ohne Zugehörigkeit zu einer Kirche.

        @Globetrotterin
        Was mir bei Ihrem zitierten Satz fehlt ist der Bezug zu Ihnen selber, was, wenn Sie sich selber nichts gutes tun wollen? Ermächtigt Sie das, auch anderen schlechtes zu tun? Für mich ist das Zitat von JC“ Liebe deinen nächsten WIE DICH SELBER“ der Leitfaden im Leben. ICH stehe im Mittelpunkt meines Lebens und von mir aus kann ich Gutes tun, nur wenn ich mich selber so akzeptieren kann, wie ich bin, mich so lieben kann, wie ich bin, bin ich auch bereit anderen Gutes zu tun und andere zu lieben. Diesen Leitfaden habe ich auch meine Kindern bis jetzt erfolgreich mit auf den Weg gegeben, diese Sicherheit, dass sie in sich selber das Glück und die Liebe finden.

      • Globetrotterin sagt:

        @Widerspenstige:
        Auch ich bin katholisch erzogen worden, und das sogar in einem katholischen Mädchen-Internat. Ich kenne diesen Hokuspokus in- und auswendig und zur Genüge! Mit Buddhismus habe ich mich nur am Rande beschäftigt und kenne mich damit wohl nicht so gut aus wie Sie.
        Aber – und jetzt kommt mein grosses ABER: Sie schreiben, dass Sie durch den Buddhismus erkannt haben, dass Ihnen der christliche Glaube indoktriniert wurde – oder verstehe ich das falsch? Woraus schliessen Sie, dass es sich beim Buddhismus nicht ebenfalls um Indoktrination handeln könnte? GLAUBENslehre = GLAUBENslehre. Es kommt nur darauf an, in welchen Kulturkreis wir hineingeboren wurden. Alle patriarchalen Völker haben einen Vatergott an der Spitze ihrer Religion (ich weiss, dass das bei Buddha vielleicht anders interpretiert werden könnte, aber er wird nun mal auch als männliches Wesen dargestellt, und auch der Buddhismus ist fest in Männerhand). Die angeblichen Gesetze und Ge- und Verbote dieses Vatergottes passen IMMER zu den jeweiligen Staatsgesetzen. Daher sind Religion und Staat IMMER miteinander verknüpft. Und daher ist Gott ein politisches Konzept und wird als solches in unterschiedlichen Staaten bzw. Kulturen unterschiedlich dargestellt bzw. interpretiert.
        Weshalb bedingt die Frage eines Kindes, weshalb es geboren wurde, eine metaphysische Antwort?
        Wie alt sind Ihre Kinder? Ich stelle es mir für Kinder ziemlich verwirrend vor, einmal die christliche und dann wieder die buddhistische Glaubensdoktrin vorgebetet zu bekommen. Da entscheiden zu müssen, welcher Glaube nun der richtige sei, erscheint mir für Kinder eine unglaubliche Zumutung und Überforderung. Haben Ihre Kinder auch noch die Drittlösung, dass weder das Eine noch das Andere stimmen könnte?
        „…und sie nicht unnötig auszuschliessen“. Diese Bemerkung Ihrerseits ist geradezu fundamental und zeigt – wie es schöner nicht ginge – die Machtstrukturen aller Religionen. „Entweder Du glaubst, dann gehörst Du zu uns, oder Du glaubst nicht, dann wollen wir mit Dir nichts zu tun haben.“ Nennt sich das etwa Nächstenliebe?
        Den Schaden, den religiöse Indoktrinationen bei Menschen anrichten, erkennen wir wahrscheinlich erst im Jugendlichen- und Erwachsenenalter. Nur ist er dann meist nicht mehr, oder nur mit enormen Anstrengungen, wieder gut zu machen. (Ich weiss, wovon ich rede!) Von den gesellschaftlichen Auswirkungen ganz zu schweigen!
        Was genau meinen Sie, wenn Sie schreiben „…haben eine Basis sprich Urgefühl ihrer Existenz erhalten und fühlen so festen Boden unter den Füssen wenn Schwierigkeiten in ihr Leben treten“? So in Etwa: „Der liebe Gott wird’s schon richten. Ich muss nur fest genug beten und brav sein?“
        Und zu guter Letzt: „Aber die Menschheit ist einfach noch nicht soweit, Grenzen nieder zu reissen und als FREIE WELTBÜRGER miteinander umzugehen.“ – Wenn wir nicht endlich damit anfangen, unsere Kinder auf dieses Ziel vorzubereiten und damit aufhören, sie mit Märchen und Lügen voll zu stopfen, weil es halt so schön bequem ist und in unsere Zeit passt, wird die Menschheit nie soweit sein!

      • Globetrotterin sagt:

        @Laura TI:
        Ich hätte auch Ihnen gerne geantwortet, aber, so leid es mir tut, ich kann mit Ihrem Kommentar absolut nichts anfangen. Wieso sollte ich mir selber nichts Gutes tun? Ich kann Sie beruhigen: Ich tue mir ausschliesslich Gutes und bin alles andere als eine Masochistin! Mir zu unterstellen, ich würde Anderen „schlechtes“ tun ist ist einfach nur dreist und infam! Wie kommen Sie zu einer solchen Unterstellung bzw. Anschuldigung?

      • Laura TI sagt:

        @Globetrotterin
        Sie haben mich völlig missverstanden, was ich aussagen wollte, war nicht auf Sie persönlich gemünzt, nur auf Ihr Zitat, das alleine reicht in meinen Augen eben nicht aus um eine „gute“ Welt zu kreieren. Es braucht auch Liebe zu sich selber, dass Sie ganz persönlich diese Liebe zu sich selber spüren und leben, davon bin ich eigentlich ausgegangen.

      • Globetrotterin sagt:

        @Laura TI:
        Wenn Sie nicht mich persönlich ansprechen, dann sollten Sie vielleicht „Sie“ nicht mit einem grossen S schreiben. Aber selbst unter dieser Prämisse verstehe ich nur „Bahnhof“.

  • Blitz Blank sagt:

    Das grösste Wunder ist es doch, dass überhaupt etwas IST. Es könnte ja einfach auch NICHTS sein. Dieses Wunder ist für mich Gott: Anfang und Ende und Baustein dieses Seins. GOTT ist der Baustein von allem und in diesem Sinne ist alles das Bildnis GOTTES. GOTT hat für mich deshalb nichts mit Glauben zu tun. Dieses Wunder des Seins ist ja hier und jetzt als Fakt erkennbar. Es braucht also Erkenntnis und nicht Glauben um das zu erkennen. Deshalb braucht es auch keine Transzendenz und Jenseitigkeit: Denn Gott hockt nicht jenseitig im Himmel auf einer Wolke, das Wunder ist mitten unter uns, durchdringt uns im Hier und Jetzt und wäre im Hier und Jetzt erfahrbar. Wir und alles anderen was IST, ist das Wunder.

  • heidi reiff sagt:

    Ich bin keine Gstudierte, bin sicher, dass ich von der Intelligenz her die Matura geschafft hätte , es gibt ja so Fernkurse oder die Minerva (Abendschule) das tu ich mir nicht an. Es gibt keine dummen Menschen, Menschen werden zu unterwürfigen Menschen gemacht durch pechschwarze Pädogig gekoppelt mit Religionen weltweit. Ich bin keine Theologin also nicht so bibelkundig, hab einige Bücher so hobbymässig über Geschichte resp. Evolution gelesen. Ich bin kein Leithammel, kein Alphatier wie so oft gesagt wird. Zum Glück wohne ich in der CH. Als Haremsdame wäre ich ungeeignet. Kinder sind immer die Opfer bei Religionsfantatismus. Freiheit ist das höchste Gut das wir Menschen haben . Ich gehe nicht in Sack und Asche, hole mal den Santitäter bei einer Rohrbruchleitung, wenn ich selbst nicht damit zurecht komme. Theorie und Praxis sind zwei Paar Schuhe, ich halte mich nach meinen Möglichkeiten an meine Praxis, Dispoten und Wüstensöhne sind für mich keine Vorbilder. Kinder sind vielseitig begabt, öffnen wir Ihnen die Tür, Kinder brauchen Feedbacks, mit liebevoller Begleitung , keine leeren Himmelsversprechungen und keine Höllendrohungen – sobald der Groschen in den Beutel fällt, die Seele in den den Himmel schwebt – so wurde ich als Kind indoktriniert in der Hl. Messen am Sonntag, resp. so betrachte ich es als kritische Erwachsene im Hier und Jetzt.

    Ich hab eine etwas gestörte Beziehung zu Geld, hat ja nichts mit Jahwe, Allah Jehova zu tun.

    Hab noch Spass an der Tastastur am Compi, vertippe mich ab und zu auch, na und…. ich leg mich jetzt zur Entspannung mal ins Bett, mein innerer Antreiber ist mein Begleiter und nicht ein Spaghettimonster …..

    Wünsche allen auf der Spielwiese und im kritischen Forum von HS viel Spass.

    • Globetrotterin sagt:

      @heidi reiff:
      Ich denke mal, Sie sind schon auf der richtigen Spur. Über die „Haremsdame“ müssten wir uns noch unterhalten. Ich habe schon oft gedacht, dass sowas – sofern es denn in Freiheit möglich sein sollte – ganz praktisch wäre. All der physische und psychische Mist, den die meisten Männer nun mal verursachen, könnte auf mehrere weibliche Schultern verteilt werden. Bei 10 Frauen müssten wir nur mehr jeden 10. Tag das Klo schrubben, und es wäre trotzdem immer blitzblank. Und wenn er dann mal wieder eine Sinnkrise haben sollte, müsste jede Einzelne auch nicht so oft ran.

    • Brunhild Steiner sagt:

      Globetrotterin: genau diese Argumente hab ich letzthin in einem Interview mit einem Massai gelesen. Der Betreffende ist Christ und verzichtet bewusst auf mehrere Frauen. Aber er sagt auch, dass die Frauen im Westen viel mehr Stress hätten als bei ihnen, weil alles in der Kleinfamilie abläuft. Bei mehreren Frauen kommen verschiedene Stärken zusammen, die eine kümmert sich um den Bereich Gastfreundschaft, die andere mehr ums Haus, die dritte um den Hof usw, und auch sonst ist alles auf mehr Schultern verteilt und das Leben angeblich entspannter.
      Naja, ich leg es jetzt nicht drauf an das auszuprobieren gehen…

      • Globetrotterin sagt:

        @Brunhild Steiner, zu 22. Jan., 19:07:
        Sehen Sie? Genau das ist auch so eine christlich-patriarchale Inszenierung. Der Gockel mischt sich unter die gackernden Hühner und sucht sich eine Gratis-Sklavin aus. Und die dummen Hühner merken nicht, wie sie vera….t werden und schreien alle: „Nimm mich, nimm mich!“ Eifersucht unter Frauen wird ganz bewusst geschürt, weil diese nämlich nur Einem dient und zugute kommt: dem Mann!

      • Globetrotterin sagt:

        Jedesmal, wenn ich ein Brautpaar sehe, überkommt mich der fast unwiderstehliche Drang auf die Braut zuzulaufen, sie zu schütteln und ihr zu sagen „Schwester, überleg‘ Dir das doch noch mal!“ – Aber das würde wohl als Neid interpretiert werden. So ver-rückt ist unsere Gesellschaft!

      • Pippi Langstrumpf sagt:

        So gut, Globe, genauso ist das mit der Eifersucht. Wer darauf hereinfällt, hat schon verloren, wir müssen unsere Sklavenmentalität ablegen und souverän werden.

      • Globetrotterin sagt:

        Antwortbutton verpasst! Mein Kommentar oben von 15:38 gehört hierher.

      • Brunhild Steiner sagt:

        @Globetrotterin: Haben Sie jetzt wirklich alles gelesen?
        Der Typ ist Christ geworden und hat sich deswegen GEGEN die Polygamie entschieden.
        Das andere sind einfach Tatsachen in ihren Lebensumständen wo einfach ALLES noch Handarbeit ist und die Menschen vorallem mit der Existenzsicherung beschäftigt sind.
        Ganz bewusst lebt dieser Mann gegen die „patriarchalen“ Strukturen seiner Gesellschaft,
        weil er vom- von Ihnen so angefeindeten patriarchalen Vatergott- begeistert worden ist…

      • Jutta Blühberger sagt:

        Ach Brunhild. Die Globetrotterin versteht sowenig von Anthropologie und ähnlichem wie eine Maus vom Fliegen. Das hab ich schon bei der letzten Begegnung herausgefunden. Diskussion zwecklos, solche Leute muss man halt einfach stehen lassen.

      • Brunhild Steiner sagt:

        @Globetrotterin: die Nachfrage wie Sie nun die ausgesprochene Anti-Zinshaltung des bibilschen Gottes mit Ihrem Vorwurf, Zinstreiberei sei aus dieser patriarchalen Religion geboren worden, in Übereinstimmung bringen, ist in einer Warteschublade gelandet.
        Aber was anderes fällt mir auch immer wieder auf, Ihnen scheint es unmöglich zu sein, sich eine glückliche Ehe vorzustellen, ist dieses Bild nicht ein bisschen eingeengt? Okay, die Scheidungsraten sind unübersehbar, aber kennen Sie in Ihrem Umfeld wirklich nur unglückliche und gescheiterte Beziehungen? Nirgendwo wirklich langjährige, erfüllte, zufriedene Paare?
        Ich frage, weil ich nicht wenige langjährige kenne, wir alle erleben die Ehe als Garten, den wir entweder pflegen- was auch mit Schweiss und Muskelkater verbunden ist, oder ihn verwildern lassen, dann müssen wir uns aber nicht über abnehmende Ernten und wuchernde Dornen wundern.

      • Globetrotterin sagt:

        Also, Brunhild, bei aller Liebe: „Der Typ ist Christ geworden“ – Eben! Ob seine ursprüngliche Kultur, Religion, Zivilisation patriarchal organisiert ist, wissen wir vorläufig nicht. Polygamie sagt diesbezüglich nicht viel aus (siehe mein Kommentar an heidi reiff oben), und – ich gebe es offen zu – über die religiöse Strukturierung der Massai-Stämme bin ich jetzt grad nicht so auf dem Laufenden. Eines aber weiss ich: JETZT GEHÖRT ER MIT SICHERHEIT ZU EINEM PATRIARCHALEN VEREIN!

      • Brunhild Steiner sagt:

        @Globetrotterin: okay, aber können Sie wenigstens schlucken dass er sich mit seiner Neumitgliedschaft in einem patriarchalen Verein umgehend gegen andere patriarchale Vorgaben gestellt hat? 😉

      • Globetrotterin sagt:

        @Brunhild Steiner:
        Wenn Sie das glücklich macht!? Ich sehe allerdings nicht, worin da ein Vorteil bestehen soll.

    • Brunhild Steiner sagt:

      @Globetrotterin: muss die Gelegenheit nutzen wenn ich hier offenbar durchkomme,
      wie ist das nun, wer steuert da ganz bewusst dass Helfende immer weniger werden?

      • Globetrotterin sagt:

        @Brunhild Steiner
        Wenn eine Gesellschaft es zulässt, dass sich ein paar Wenige auf Kosten Vieler unermesslich bereichern (ich denke z.B. an D. Vasella, M. Ospel, die ganze Banker-Gilde, etc.) und auch noch die entsprechenden Strukturen dafür schafft, dann steckt dahinter System. Und dann heisst es ja auch noch „Wer zahlt, befiehlt“. Geld wird nicht nur angehäuft, um im Luxus zu schwelgen. Geld bedeutet Macht, mit Geld kann man bei uns offensichtlich alles und jeden kaufen. Mit solchen falschen Anreizen werden Menschen willkürlich zu Egoisten erzogen.

      • Globetrotterin sagt:

        Brunhild Steiner:
        Ich habe geantwortet, wenn auch erst heute Morgen. Geduld ist angesagt.

      • Globetrotterin sagt:

        Ich muss meinen Kommentar von 10:10 noch ergänzen:
        Wir werden ganz bewusst zu Egoisten herangezüchtet, denn das ist gut für die Wirtschaft. Je gieriger wir werden, umso schneller laufen wir im Hamsterrad, umso mehr sind wir gewillt, freiwillige Überstunden zu leisten. Das ist die Geschichte vom Esel, dem der Reiter eine Karotte an einer Angel vor die Nase hält. Wir laufen und rennen und realisieren nicht, dass wir das Rüebli nie erreichen werden.

      • Brunhild Steiner sagt:

        @Globetrotterin: Sie haben behauptet der patriarchale Vatergott stünde hinter all den Zinstreibereien etc.
        Ich habe Ihnen aufgezeigt, dass genau dieser von Ihnen angegriffene Vatergott
        strenge Gesetze gegen Zins und Wucher erlassen hat.
        Ich finde es nicht gut wenn Sie in Ihrer ganzen, auch durchaus angebrachten Empörung,
        Fakten welche das Bild ein bisschen verändern würden, einfach ausblenden.

        Sie haben nun den Bogen zur Wirtschaftselite gemacht, ich bin mit Ihnen einig!!!
        Zuvor haben Sie aber immer und immer wieder über die machtbesessenen Kirchen und ihre patriarchalen Strukturen, mit dem Oberbösewicht in Form des Vatergottes hergezogen, und das ist Tunnelblick.
        Bloss sehr wenige Kirchorganisationen verfügen über Reichtümer und intrigante Netzwerke.
        Und im AT wie im NT wird Ausbeutung und das Herz an Geld und Besitz hängen aufs Schärfste verurteilt, und zwar von Mister Patriarcho höchstpersönlich, das mag er nämlich ausgesprochen ganz und gar nicht…

      • Globetrotterin sagt:

        Wie schön, Brunhild, dass Sie trotz allem noch Ihren Humor behalten. Das schätze ich!
        Ich bin bestimmt nicht so bibelfest wie Sie. Die einzige Stelle, die ich diesbezüglich kenne, ist die, wo JC die „Banker“ aus dem Tempel vertrieben hat. Was hat’s gebracht? Sie sind sofort durch die Hintertüre wieder eingezogen.
        Und: Wenn ich in diesem Zusammenhang das Wort „Elite“ höre, sträuben sich mir alle Nackenhaare. Da kriege ich einen Weinkrampf (weinen – nicht trinken!) – vielleicht sollte ich einen Lachkrampf daraus machen.

      • Globetrotterin sagt:

        @Brunhild Steiner:
        Noch was zu Ihrem letzten Absatz oben:
        Wenn Sie nicht realisieren, was uns damit gesagt werden soll, dann weiss ich einfach nicht mehr weiter. „Mister Patriarcho“ teilt seinem Fussvolk mit, dass es schön klein und bescheiden bleiben soll. Alles andere ist nur für die „Eliten“ bestimmt.
        Genauso wie die „Unberührbaren“ im Hinduismus. Die sollen sich hier mal schön abrackern ohne zu murren. In ihrem nächsten Leben werden sie dafür mit dem Aufstieg in die Kaste der Brahmanen belohnt. So verhindert man Revolutionen. Und die Ungebildeten sollen ungebildet bleiben, damit sie nichts merken und schön ruhig sind.

      • tobe or not tobe sagt:

        Muss einfach sagen, dasses schön ist Leute zu treffen die hinter die Fassaden blicken und nicht alles vorgekaute, widergeben ohne selber zu hinterfragen.

        Hoffe es folgen noch mehr Leute mit Einsicht.

        @Globetrotterin: Ich muss gar keine Kommentare mehr schreiben, sie geben alles wieder was mir auf der Seele brennt.. Danke 🙂

      • Globetrotterin sagt:

        tobe! Lassen Sie mich nicht alleine auf weiter Flur!

      • tobe or not tobe sagt:

        @Globetrotterin. Natürlich kannst Du mit meiner Rückendeckung rechnen. Habe aber leider nur ab und zu kurz Zeit einen Beitrag zu schreiben, da mich die Arbeit abhält .-) Aber ich seh du schlägst dich tapfer durch den Urwald von verwegenen Blogern und braunem Gedankengut das die Stille stört.

        Hasta la victoria para siempre..

      • Brunhild Steiner sagt:

        @Globetrotterin: ehm nein, Mister Oberpatriarcho mag diese sogenannten Eliten genausowenig wie wir,
        es lassen sich da wirklich ausreichend Gesetze und Verordnungen finden, schon nur die Strategie das Land nicht aufkaufen lassenwollen von Wenigen (findet sich bei den Sabbatgeboten), aber ich will Sie hier nicht mit den alten Texten erschlagen. Sich nicht daran gehalten hätten die Menschen auch ohne „seine Erfindung“, aber ob handkehrum Werte wie Nächstenliebe, Barmherzigkeit, Vergebungsbereitschaft etc einfach so entstanden wären?
        Ich denke eher nicht, finde es jedenfalls beachtenswert, dass Sie mich überhaupt gelesen haben, und dafür will ich mich nun auch mal bedanken, hat mir wirklich Freude gemacht! Und es ist nicht so, dass ich über Ihre Kommentare nicht nachdenken würde, ich schätze ein entschiedenes Kontra durchaus, denn das prüft das eigene Fundament.
        Gute Zeit…:-)

  • StefanB sagt:

    Wenn es denn einen Gott gibt (wovon ich überzeugt bin), dann ist er („er“ im rein grammatikalischen Sinn) jedenfalls transzendent, was heisst, er entzieht sich jedem menschlichen Vorstellungsvermögen – was wohl auch der Grund ist für das Gebot „Du sollst Dir kein Bildnis machen“: jedes Bild, das der Mensch sich von Gott macht, ist falsch, weil es ihm infolge Unvollständigkeit nicht gerecht wird.

    Wir Menschen sind wie die Blinden, die ins Gehege geführt wurden, um das Wesen des Elefanten zu erfahren:
    Der erste befühlte den Rüssel und behauptete, der Elefant sei lang und beweglich wie ein Schlauch
    der zweite befühlte ein Ohr und sagte: Nein, ein Elefant ist gross und dünn wie ein Salatblatt
    der dritte betastete ein Bein und sagte: Nein, ein Elefant ist dick und rund wie ein Baumstamm
    der Vierte aber stand mit dem Rücken zum Tier, fuchtelte wie wild in der Gegend umher, und sagte schliesslich: der Elefant existiert nur in eurer Phantasie.

    • Globetrotterin sagt:

      @Stefan B:
      Auch wenn es denn keinen Gott gibt (wovon ich überzeugt bin), ist Dein Gleichnis trotzdem sehr schön.

      • fufi sagt:

        Ich würde jetzt mal sagen:
        JC hat uns Menschen ALLES gesagt, was wir über „Gott“ wissen müssen (und können).
        🙂

    • Widerspenstige sagt:

      Ja, StefanB, Dein Gleichnis mit dem Elephanten gefällt mir sehr gut und beschreibt sämtliche mögliche Thesen/Hypothesen darüber. Wohl dem, welcher sich in diesem Labyrinth auszukennen glaubt und sich NICHT nur im Schwarz-Weiss-Denken auskennt.

    • Orlando S. sagt:

      Das ist sehr schön gesagt: Aber das Gleichnis stellt nur auf den Tastsinn ab. Wenn so ein Elefant im Raum steht, dann hört man ihn, riecht ihn, spührt seine Anwesenheit!

      Der Atheist wäre dann ein Blinder, der kurz reinschaut und sagt: „Ich kann da nichts sehen, es gibt folglich keinen Elefanten“.

      Gerade weil wir blind sind, sollten wir eben offen sein und unsere anderen Sinne um so geschärfter einsetzen 🙂

      • Logine sagt:

        Ein Philosoph und ein Pfarrer streiten sich darum, welcher der beiden von ihnen vertretenen Disziplinen der höhere Rang zukomme. Spöttisch meint der Pfarrer: „Philosophie ist, als ob jemand in einem dunklen Raum mit verbundenen Augen eine schwarze Katze sucht, die es gar nicht gibt.“ Darauf antwortet der Philosoph: „Theologie ist, als ob jemand in einem dunklen Raum mit verbundenen Augen eine schwarze Katze sucht, die gar nicht da ist und plötzlich ruft: Ich hab sie!“

      • Globetrotterin sagt:

        SUPERGENIAL! Ich hab mich mal wieder schief gelacht!

      • StefanB sagt:

        Logine, ja, der ist nicht ohne. Allerdings hast Du den Wissenschafter unterschlagen, der zuerst an die Rehe kommt und sagt, „Wissenschaft ist, in einem dunklen Raum mit verbundenen Augen eine schwarze Katze zu suchen.“

  • Cara Mia sagt:

    Diskussionen um Gott sind völlig müssig. Wer einen Gott braucht, Homöopathie, Handauflegen, Horoskop, Tischleinrücken und sonstigen jenseitigen Gugus, der soll’s doch haben, so lange er die andern damit in Ruhe lässt.

    • Globetrotterin sagt:

      @Cara Mia:
      Im Prinzip bin ich Deiner Meinung. Das Problem ist nur, dass Religion auf unser Leben und unseren Alltag einen unermesslich grossen Einfluss nimmt. Das geschieht sehr subtil, ohne dass wir uns dessen bewusst sind. Wir alle, ob Gläubige oder Nichtgläubige, sind diesen Einflüssen unterworfen. Solange wir nicht darüber nachdenken, merken wir es nicht und bleiben in dieser Falle gefangen. Vielleicht braucht es ein neues Zeitalter der Aufklärung. Nein: nicht vielleicht, bestimmt sogar.

      • Cara Mia sagt:

        Das Problem ist die Frage, wer denn aufklären soll. Wir alle wissen genau gleich viel. Es müsste also jeder selber drauf kommen, dass es einen Gott logischerweise gar nicht geben kann. Wer aber religiös ist, WILL das nicht wissen, er will seinem Traum nachhangen. Träume halten viele halt am Leben!

      • Globetrotterin sagt:

        @Cara Mia:
        Aus genau DIESEM GRUND MUSS Gott von der Schule fliegen!

  • Pippi Langstrumpf sagt:

    560 Kommentare bist jetzt, und das zum Thema „Religion“.

    Finde ich sehr erstaunlich, dass die Leute offenbar immer noch so fasziniert sind davon.

    • tobe or not tobe sagt:

      omnipresent..:-)

      • Globetrotterin sagt:

        Hab ich’s doch geahnt!

      • Pippi Langstrumpf sagt:

        Was hast du geahnt, Globe?

      • Globetrotterin sagt:

        Meine beiden Beiträge gestern Abend gingen in die Warteschlaufe. Darauf habe ich an tobe eine Mitteilung verfasst, dass ich ihm zwar geantwortet hätte, meine Antwort aber noch nicht durchkam. Auch diese Mitteilung kam in die Warteschlaufe. Ich habe ihm dann nochmals geschrieben, dass meine Mitteilung darüber, dass meine Kommentare in der Warteschlaufe gelandet sind, ebenfalls in die Warteschlaufe geriet, was wiederum die Warteschlaufe aktivierte. Das habe ich dann schon vorausgeahnt.

    • Globetrotterin sagt:

      Ich wünsche mir nochmal 560 Kommentare, denn das ist das grundlegendste Thema überhaupt in unserer Zeit. Religion beeinflusst unser ganzes Leben, unseren ganzen Planeten. Religion ist Politik, Religion ist Krieg, Religion ist Hunger, Religion ist Frauenverachtung, etc., etc.. Auch wenn sie noch so lange genau das Gegenteil behauptet.

      • Brunhild Steiner sagt:

        Ich behaupte nicht das Gegenteil, sondern dass dies Fehlentwicklungen waren und sind,
        und Sie die vielen konstruktiven und gemeinschaftsfördernden Auswirkungen im Bereich Sozialeinsatz als es noch keine Sozialwerke gab komplett unterschlagen.
        Selbst heute wird sehr viel unentgeltliche Hilfe von Menschen geleistet welche in irgendeiner Art und Form „transzendent inspiriert“ sind.

      • Globetrotterin sagt:

        @Brunhild Steiner:
        Dafür braucht es keine Religion, sondern Menschen, denen Empathie nicht abtrainiert wird.

      • Blitz Blank sagt:

        „denn [Religion] ist das grundlegendste Thema überhaupt in unserer Zeit.“

        Da muss ich dezidiert widersprechen: Die Wirtschaft ist das grundlegendste Thema unserer Zeit (und vermutlich aller Zeiten) über das diskutiert werden sollte. Die Wirtschaft bestimmt das Leben aller Menschen in viel grösserem Masse wie Religionen. Und im Gegensatz zu den klassischen Religionen, wo es Alternativen gibt, wird von der Super-Religion „kapitalistische Marktwirtschaft“ behauptet, sie sei alternativlos (Unwort des Jahres 2010). Also eine Diskussion darüber nicht möglich.

      • Globetrotterin sagt:

        Wie ich in meinem – nun doch noch veröffentlichten – Kommentar von 08.16 gesagt habe, hängen Religion (Patriarchat) und Kapitalismus (Wirtschaft) unmittelbar zusammen, ja sind geradezu von einander abhängig. Wenn man die Zusammenhänge überdenkt, geht einem/r ein Licht auf.

      • Brunhild Steiner sagt:

        @Globetrotterin: offenbar haben diese Menschen aber gefehlt,
        denn diese „transzendent inspirierten“ Menschen wurden aktiv weil es noch nichts gegeben hat…

      • Globetrotterin sagt:

        @Brunhild Steiner:
        Sie fehlen immer noch und werden immer weniger. Das aber wird konsequent so gesteuert. Die Menschen werden systematisch verdummt, unter anderem auch durch Religion. Dagegen müssen wir ankämpfen und unsere grauen Zellen mobilisieren.

      • Globetrotterin sagt:

        @Brunhild Steiner:
        Auch hiezu habe ich Ihnen geantwortet. Aber es dauert….Geduld – vielleichts wird’s ja noch.

      • Globetrotterin sagt:

        Wo bleibt meine Antwort an Brunhild Steiner? Sind meine Beiträge wirklich so reaktionär, dass man sie nicht veröffentlichen darf? Wovor hat „man“ hier Angst?

      • Brunhild Steiner sagt:

        @Globetrotterin:
        „Sie fehlen immer noch und werden immer weniger. Das aber wird konsequent so gesteuert.“
        Da komm ich nun nicht mit, was genau meinen Sie damit?
        Ich bezog mich auf die Gründung von Institutionen welche sich um Waisenkindern, Witwen resp. allgemein Frauen, Arme, Benachteiligte, Kranke bis zu Gefängnisinsassen gekümmert haben und dies noch heute tun.
        Desweiteren kenne ich sehr viele Menschen, welche auf ein Leben in angenehmen Umständen verzichtet haben um sich für andere einzusetzen,
        entweder indem sie selber zu den Benachteiligten hingehen (das kann ein Dorf in Afrika oder ein Slum in einer Gigastadt sein) oder Menschen die dort hingehen finanziell unterstützen.
        Auch Organisationen wie WWF, Greenpeace, Amnesty, schweizbezogene Hilfswerke für Naturschutz, Benachteiligte, Kranke usw., oder die neueren Protestgruppen welche sich auf die global Players konzentrieren-
        dort überall finden Sie sehr engagierte Menschen denen Unrecht nicht egal ist und die bereit sind, sich die eigenen Hände und Füsse schmutzig zu machen.
        Klar hat es immer zuwenig welche ebenfall zupacken, aber mit Sicherheit steuert da nicht irgendeine kirchliche Institution Desinteresse am Helfenwollen. Eher im Gegenteil.

      • Brunhild Steiner sagt:

        @Globetrotterin:
        „Sie fehlen immer noch und werden immer weniger. Das aber wird konsequent so gesteuert.“
        Wie genau meinen Sie das?
        Es gab sie in der Vergangenheit und es gibt sie in der Gegenwart. Persönlich kenne, resp. weiss ich von vielen die ihr bequemes Leben zugunsten dem Einsatz von Benachteiligten aufgegeben haben, sei es in einem afrikanischen Dorf, im peruanischen Hinterland oder im Slum von einer Gigapole.
        Und ich kenne Menschen welche auf einen bequemen Lebensstil verzichten um diese anderen das Engagement finanziell zu ermöglichen. Das sind, zugegeben, sehr „transzendent inspirierte“.
        Aber es gibt auch viele säkulare Hilfswerke, ob für die Natur, die Tiere, den Menschen, globalere wären da WWF, Greenpeace und Amnesty, es gibt aber auch viele europa- oder schweizbezogene.
        Natürlich fehlt es immer an Menschen welche bereit sind die Ärmel hochzukrempeln und sich die Hände selber schmutzig zu machen. Aber dass das Desinteresse an Einsatz für den Mitmenschen von kirchlichen Organisationen gesteuert sein soll, da bin ich eher vom Gegenteil überzeugt.

        Das wär Versuch zwei einer Antwort.

      • Globetrotterin sagt:

        @Brunhild Steiner:
        Sorry, da ich LEIDER keinen Butler habe, muss ich mich hin und wieder auch um ganz profane alltägliche Dinge kümmern und schaffe es deshalb nicht, ununterbrochen am Computer zur Verfügung zu stehen. Aber zurück zum eigentlichen Thema:

        Woher, denken Sie denn, haben Kirchen ihre Macht, ihren Einfluss, Ihr Geld? Warum wohl pilgern sämtliche Regierungschefs und Staatsmänner/-frauen und alles was in unseren Gesellschaften Rang und Namen hat nach Rom um sich vor dem „Heiligen Vater“ auf die Knie zu werfen? Mehr Macht und Einfluss als dort gebündelt sind, gibt es sonst wohl nirgends. Und da soll diese Kirche dann keinen Einfluss auf unser politisches/gesellschaftliches System nehmen können? Was denken Sie, geht in der Vatikan-Bank (ich glaube, das ist die „Banca Ambrosiana“, müsste es aber nachsehen um sicher zu sein) ab? Mehr und grössere Intrigen und Kapitalverbrechen finden Sie kaum anderswo. (Buchtipp: „Die Macht des Geldes“) Und sagen Sie mir jetzt ja nicht, dass sowas wohl nur in der katholischen Kirche vorkommt. Bei JEDER Religion – auf jeden Fall bei den monotheistischen – geht es zunächst einmal um Macht und Geld. Grössere Kirchen = grössere Verbrechen, kleinere eben kleinere oder weniger. Betrug in dieser Hinsicht gab es sogar schon beim Orakel zu Delphi.
        Natürlich haben Sie recht, wenn Sie all die Organisationen erwähnen, die sich sozial engagieren. Glücklicherweise gibt es noch Menschen mit Empathie. Aber was haben Amnesty, WWF, Greenpeace etc. mit Religion zu tun? Ich wüsste nicht, dass irgendeine Kirche zu deren Hauptsponsoren gehörte. Ich empfinde es als Schande der Menschheit, dass es solche Organisationen überhaupt braucht, dass wir nicht fähig sind, mit Mitmenschen, Tieren, Ressourcen, generell mit diesem Planeten friedlich und in Einklang mit der Natur umzugehen. Stattdessen wird die „Geiz-ist-geil“-Mentalität gepredigt, Ressourcen werden nur ein paar wenigen Auserkorenen zugestanden, das Angebot an allem wird künstlich knapp gehalten um Konkurrenz, Neid und Eifersucht zwischen den Menschen zu säen. Macht, Herrschaft und Hierarchie wurden installiert. Bildung ist längst nicht allen zugänglich. Glauben Sie wirklich, das alles ist einfach so vom Himmel gefallen oder hat sich halt „irgendwie ergeben“? Hinter all dem steckt System, und an diesem System arbeiten Religionen an vorderster Front mit. Woher, denken Sie, kommt das Zinses-Zins-System, womit die Menschen in Abhängigkeit gebracht und gehalten werden? Dieses ganze, schaurige und menschenunwürdige System gibt es erst, seit die Menschen den „Vatergott“ erfunden haben. Schauen Sie doch mal hinter die Kulissen und lassen Sie sich nicht nur vom „schönen“ Schein blenden.

        Ich hoffe, mein Kommentar ist nicht zu lang geworden. Ich habe versucht, mich auf das Wesentliche zu beschränken, obwohl es dazu noch viel mehr zu sagen gäbe.

      • Globetrotterin sagt:

        @Brunhild Steiner:
        Nicht bei mir reklamieren – die Verzögerung liegt woanders.

      • Brunhild Steiner sagt:

        @Globetrotterin: ich habs bloss zweimal geschickt weil ich nicht sicher war
        ob vielleicht die erste Ausgabe unterwegs zerfleddert wurde,
        bezüglich Verzögerungen und ähnlichen Unanehmlichkeiten verdächtige ich Sie mit Sicherheit nicht!…;-)
        Aber wer da nun was gezielt steuert, da komm ich immer noch nicht mit:
        “Sie fehlen immer noch und werden immer weniger. Das aber wird konsequent so gesteuert.”

      • Brunhild Steiner sagt:

        @Globetrotterin:
        tja, der Butler fehlt mir auch leider…;-)
        „Aber was haben Amnesty, WWF, Greenpeace etc. mit Religion zu tun?“
        Nichts, ich hab ja geschrieben „Aber es gibt auch viele säkulare Hilfswerke“,
        okay, erst im zweiten Durchgang, im ersten noch nicht, da es mir vorallem um Ihren Satz
        „es werden immer weniger und das ist gezielt so gesteuert“ gegangen ist
        und ich einfach mal ein bisschen aufzählen wollte wer sich da alles engagiert.
        Das mosaische Gesetz gebietet dem Armen zu leihen und
        untersagt bei der Rückerstattung einen Aufschlag zu fordern!
        Die Hilfe am Nächsten sollte explizit nicht zu einem Geschäft werden.
        Es gab auch die Weisung dass alle 50 Jahre erworbenes Land an den ursprünglichen Besitzer zurückgegeben werden muss, so sollte vermieden werden dass sich im Laufe der Zeit ein paar wenig Gutbetuchte sich das ganze Land unter den Nagel reissen konnten.

        Wenn Sie da eine Verschwörung vermuten, dann bitte bei denen welcher der Religion des Mammon huldigen, welche übrigens im AT wie auch im Neuen Testament sehr scharf verurteilt wird. Dort fallen sehr harte Sätze was den Umgang mit Geld und das Herz ans Geld und Besitzhängen betrifft.

        Längst nicht alle Kirchen haben Macht und Einfluss!!! Es sind ein paar Wenige die darüber verfügen, die anderen leben bescheiden, verfügen weder über angehäufte Reichtümer noch über intrigante Netzwerke, sondern versuchen nach bestem Wissen und Gewissen ihre Glaubensauffassungen in Alltag zu übersetzen.
        Vergessen Sie in Ihrer angebrachten Empörung (ich bin das auch wenn mir diese negativen Dinge vor Augen halte) bitte einfach nicht, dass es die andere Seite auch gibt.

      • Brunhild Steiner sagt:

        @Globetrotterin: ich hoffe dieses Stück kommt schön brav auch in die Zwischenschublade, damits dann Sinn macht mit dem schon Geschickten…
        „Dieses ganze, schaurige und menschenunwürdige System gibt es erst,
        seit die Menschen den “Vatergott” erfunden haben.“
        Eben, siehe oben, stimmt eben überhaupt nicht, dieser von Ihnen angegriffene Vatergott war entschieden gegen die Zinstreiberei und hat entsprechende Gesetze verabschiedet um es mal salopp auszudrücken,
        der war nicht so schlecht wie Sie ihn hinstellen.

      • Brunhild Steiner sagt:

        okay, das hats jetzt glatt geschafft, im noch nicht oben stehenden Text beziehe ich mich auf die mosaischen Gesetze welche eine Pflicht dem Armen zu helfen kennen, und ein Verbot die Rückzahlung mit Aufschlägen zu versehen.

      • Brunhild Steiner sagt:

        Und die wenigsten Kirchen verfügen über Reichtümer und intrigante Macht-Netzwerke,
        hoffe der Text wo alles in Einem steht kommt dann noch irgendwann.
        In der Empörung über Unrecht sind wir uns jedenfalls einig, das ist doch schon etwas…

    • Orlando S. sagt:

      tja, auf einem Gebiet, wo man selber unterentwickelt ist, weil man in den bequemen 70erjahren steckengeblieben ist, wo solche Diskussionen Tabu waren (oder mit einem „Opium des Volkes“, „Überbau des Patriarchats“, „Reaktionäre Agitation“ binnen Sekunden erledigt waren) da erschrickt frau schon, wenn sie feststellen muss, wie virulent Glaubensfragen über Klassen-, Geschlechter- und Generationengrenzen hinweg tatsächlich sind. Anschluss verpasst – „das stand aber nie in der Emma!“

      Uahaha!

      • Pippi Langstrumpf sagt:

        Sag mal, Furioso, tut das eigentlich nicht weh, wenn man dauernd solchen Mist von sich gibt? Immer zeuseln, du bist entwicklungsmässig ungefähr bei 7 Jahren stehengeblieben. Du solltest anfangen, regelmässig die EMMA zu lesen, vielleicht besteht sogar für dich Hoffnung auf ein bisschen Erkenntnis.

      • Globetrotterin sagt:

        Pippi, glaubst Du noch an den Weihnachtsmann? Manchmal ist halt eben „Hopfen und Malz verloren“. Auch damit muss frau leben.

      • Orlando S. sagt:

        Ich lese lieber in der BIBEL: „Beati pauperes spiritu, quia ipsorum est regnum coelorum “
        (Matthäus 5, 3)

        Er hat das durchaus auf Leute wie sie beide bezogen.

      • Pippi Langstrumpf sagt:

        Du bist so ein elender Wichtigtuer (nicht anerkennend gemeint!), versuchst uns hier gerade zu erzählen, dass du die Bibel auf lateinisch liesst? Komm runter, Komiker.

      • Globetrotterin sagt:

        Honi soit qui mal y pense…

      • StefanB sagt:

        non cogito Orlandonem in evangelio linguae latinae legendem.

      • StefanB sagt:

        Nein, ehrlich, er zitiert doch wieder nur ein paar Bibelsprüche, die er im WWW findet.

      • fufi sagt:

        @Orlando

        Ich lese auch gerne in der Bibel. Aber ich weiss, dass alles Lateinische bloss übersetzt ist.
        Und drum lese ich’s nämlich auf griechisch, und da heissts so – ungefähr:
        „Makarioi hoi ptoochoi too pneumati hoti autoon estin hä basileia toon ouranoon“
        Und naja, das heisst – unter Einbezug der Konnotationen – leider nicht wirklich das genau gleiche, als wie auf lateinisch.
        Aber musst keine Angst haben, auch und gerade wenn du arm im Geist sein solltest!
        😀

      • Orlando S. sagt:

        Tatsächlich habe ich eine sehr schöne handkolorierte Vulgata zuhause, aus dem Antiquariat, hat mich ein halbes Vermögen gekostet. In der lese ich gerne abends im Schein des Cheminéefeuers bei einem Glas Chassagne-Montrachet, nachdem ich die beiden Dobermänner im Park vor dem Haus spazierengeführt habe.
        Beim Genuss einer Romeo y Julieta denke ich dann stets in der Chaiselongue liegend, die Hirschgeweihe über der Galerie und die Poträtbilder meiner Ahnen darunter betrachtend über das Gelesene nach. Dann, in einer Cognac-Laune, starte ich manchmal den PC und lasse den Mamabl0g-Pöbel an meiner Erkenntnis teilhaben.

      • Katharina sagt:

        Naja O. genaugenommen sind sie , wenn sie tatsaechlich die paar kroeten mehr fuer die chaise longue haben, im besten fall ein parvenue.

        sprachlich erinnern mich ihre beitraege eher an die tough guys der lower east side, bzw dann in zuerich die entsprechenden stadtkreise. als sterotyp eben so ein richtiger zueri-hegel. baugewerbe vielleicht? bodenleger? so etwa.

      • fufi sagt:

        Orlando als Bodenleger?
        DANN würde ich glaub noch lieber auf Sand bauen!

      • Globetrotterin sagt:

        …oder mir meine Fliesen selber legen.

      • Globetrotterin sagt:

        @Orlando:
        Discusting, dekadent, dumm und überheblich! Sie kann man wirklich nicht mehr ernst nehmen.

      • Auguste sagt:

        hmm…, vulgata? die namen für diese dinger werden immer ausgefallener. dass man sie jetzt sogar selbst bemalen kann – entzückend.

      • fufi sagt:

        @Pippi am 22.1., 7:17

        Wenn DAS und Dummheit weh täte, würde ich mein ganzes Vermögen in Aktien von Firmen investieren, die Schmerzmittel herstellen!
        😛

      • fufi sagt:

        @Auguste

        Kennst du das denn nicht:
        BASTELN SIE SICH IHREN PERSOENLICHEN GLAUBEN.
        Bausätze ab Fr. 9.95, farbig ab 49.95!
        🙁

      • fufi sagt:

        Neinei:
        „Vulgata“ hat nichts mit „vulgär“ zu tun.
        DAS ist ehrlich!
        😀

      • Auguste sagt:

        hmm…, wissen sie, fufi, die jungs, die sich solch „freundinnen“ bestellen, müssen schon über eine gehörige portion glauben verfügen, sonst kommt da wohl keine stimmung auf.

      • Auguste sagt:

        hmm…, fufi, switchen sie mal ins paralell-universum. mir sind bei „big m“ die satirischen gäule ein wenig durchgegangen – sie könnten’s mögen.

      • Orlando S. sagt:

        @fufi: ja, wir „basteln“ uns unseren Glauben in der Tat selber und brauchen scheinbar keine Anleitung von Theologen ihres Schlags. DAS wäre doch wahrhaft protestantisch, nicht? Leider ertrage ich ihre ungeheizten Kirchen und die theologisch unbedarften Wellness-Allerweltspredigten nicht mehr.

        Ich bin sehr gespannt auf ihre Entgegnung zu meinem heutigen 00.47.

      • fufi sagt:

        @Auguste

        Hat vielleicht eher mit Dollars zu tun. Aber das scheint ja auch ein recht verbreiteter Glaube zu sein.
        Und namal: „Vulgata“ bezeichnet NICHT den berühmt-berüchtigten „Geschlechtergraben“!

      • Das Einhorn sagt:

        Vulgär bedeutet nichts anderes als gewöhnlich, damit hängt Vulgata zusammen. Vulgär ist nicht dasselbe wie obszön.

      • fufi sagt:

        ans einhorn:

        HEUTE hat selbige Vokabel aber genau DIESE Bedeutung!
        Ok, hab mich etwas „zu kurz“ ausgedrückt!

      • Das Einhorn sagt:

        Ich weiss, Fufi, aber von DIR erwarte ich halt die genaue Ausführung, wir sind hier verwöhnt…… 🙂

      • fufi sagt:

        Ehrlich: Danke
        😀

      • fufi sagt:

        Orlando S. sagt:
        23. Januar 2011 um 01:05

        unter anderem:
        Hirschgeweihe über der Galerie und die Poträtbilder meiner Ahnen darunter

        Cornuti?

        😀

      • fufi sagt:

        Orlando S. sagt:
        23. Januar 2011 um 01:05
        unter anderem:

        Dann, in einer Cognac-Laune, starte ich manchmal den PC und lasse den Mamabl0g-Pöbel an meiner Erkenntnis teilhaben.

        Tja, so nüchtern betrachtet, kann das ja vieles erklären!
        😛

      • Globetrotterin sagt:

        Und, dass Orlando eine Frau hat, die sich um den ganzen subalternen Mist kümmert, während er – in seiner Chaise longue liegend – an seiner Romeo y Julietta pafft, genüsslich die Hirschgeweihe und seine Ahnenbilder betrachtet, vor sich hin sinniert, um sich dann in einer grosszügigen Geste ans gemeine Volk zu richten, versteht sich ja von selbst!

    • Pippi Langstrumpf sagt:

      Also schon wegen der grossartigen Musik, die Bach für den lieben Gott geschrieben hat, bin ich eigentlich mit dem Christentum ausgesöhnt. Unvorstellbar, wenn wir auf all die Werke verzichten müssten, die zu Ehren dieses Gottes erschaffen wurden.

      Ich höre den ganzen Tag Klassikradio.de auf 96,1 (oder im Internet), im Moment läuft Toccata & Fuge, diese Klänge sind so wunderbar……..

      • Brunhild Steiner sagt:

        🙂 noch unzählig viele musikgeniessende Stunden 😉

      • Orlando S. sagt:

        Die H-Moll-Messe ist vielleicht das grösste, was zu Gottes Ehren in Tönen geschrieben wurde.

        Hm, sie sind auf meiner Sympathieskala gerade 0,1 Punkte höhergerückt, gratuliere! Aber Pippi: Klassikradio, wirklich? Ich finde das seichte Dauerberieselung nonstop, mit einem Klangteppich aus Film und anderer leichter Kost. Da lobe ich mir unser staatliches 2. Hörfunkangebot mit all dem nutzlosen Gebrabbel von überkandidelten Phil.-Hist.-Frauen, die langatmige Beiträge zu exotischen Themen mit null Relevanz senden, geradezu.

      • fufi sagt:

        Bin definitiv KEIN Bach-Fan.

        H-Moll messe gefällt mir super, aber viele andere seiner kirchlichen Werke … was solls.
        Aber Pippi hat recht: „Das Christentum“ hat sich wirklich nur schon wegen der wunderschönen Musik(en) gelohnt!
        🙂
        Mozart: Krönungsmesse
        Schubert: Deutsche Messe
        Berlioz: Grande messe des morts
        und für LiebhaberInnen:
        Hindemith: Sancta Susanna
        😀

      • fufi sagt:

        @Orlando

        Wenn DU mal nichts zum kritisieren findest!
        Wie hiess es früher:
        Wirst wohl dem Pfarrer auch NACH deiner Abdankung noch ………. .

      • fufi sagt:

        Pippi

        Kennst du:
        Charles Ives: The unanswered question?

        definitiv nicht bacchiantisch
        und dauert auch nur so etwa 7 Minuten.

        Also ICH finds gelialistisch!
        😛

      • Orlando S. sagt:

        @Dämlichschwatz-fufi:

        Mozart: C-Moll-Messe
        Bach: Matthäus-Passion
        Verdi: Requiem
        Brahms: Deutsches Requiem
        Stravinsky. Symphony of Psalms
        Schönberg: Moses und Aaron

        Darunter ist ihr Niveau, es ist Klassik-Radio-Niveau. Schwülstige Seichtgebiete.

      • Orlando S. sagt:

        oh, wie nett, „Cornuto“!

        „Unanswered Question“ passt ja zu deinem Unvermögen, konzise Aussagen zu machen. Yves hat viel interessantere Sachen geschrieben, aber wenn man wie du stets nur an der Oberfläche dümpelt, kann man das ja nicht wissen.

  • fufi sagt:

    Möchte vielen hier einen MOGROS-Kurs empfehlen
    und zwar in „Erkenntnistheorie“
    so nach dem Motto:
    Welche Gründe haben wir, glauben zu dürfen, dass das, was wir zu wissen meinen, wahr sein könnte.

    und damit haut fufi das Photon für heute ab in den Hyperraum!
    😛

    • Globetrotterin sagt:

      Das ist sicherlich ein Kurs für Theologen – die sollten diesen auch besuchen!

    • Orlando S. sagt:

      also, sie fluffy fufie! Beziehe mich auf ihre Aussage von heute Nachmittag (Theologie VON Dummies): erklären sie uns in drei Sätzen (max. 5 Zeilen) worum es im Christentum geht.

      Hopp!

      • Globetrotterin sagt:

        @Orlando:
        Sobald Ihre „Intelligenz“ gefordert wird, rufen Sie nach Helfern!
        (Ja, ja, so sind sie, die Sprücheklopfer)

      • Orlando S. sagt:

        nein, er mutet es sich zu, es besser als ich erklären zu können, unser verhinderter Geistlicher. Soll er mal liefern.

      • fufi sagt:

        Ich Christentum geht’s darum, einem Mitmenschen NICHT mit derselben Hässigkeit, Feindseligkeit und Arroganz gegenüberzutreten, wie selbige das einem sich als Christen bezeichnenden Menschen nur allzuoft und allzugerne tun – wozu IHR Kommentar ein SEHR gutes Beispiel abgibt, was Satz 1 ist!). Satz 2 beinhaltet, dass wir Christen zu unserem Seelenheil nichts aber auch gar nichts beitragen können, weil uns das nämlich von Gott her eh geschenkt wird und wir selbiges aus eigenem (religiösen) Tun eh nicht erreichen könnten. Daraus folgt schliesslich der dritte satz, welcher besagt, dass wir Christen unter diesen Umständen darauf verzichten dürfen, nicht christen in einer wie auch immer aber jedenfalls feindlichen Haltung zu begegnen.

      • Orlando S. sagt:

        Mit kommen die Tränen. Ich wollte von einem Ex-Theologen etwas brauchbares über das Christentum erfahren und ausser „die andere Wange hinhalten“ kommt nichts als warme Luft.

      • fufi sagt:

        Orlando:
        Sie haben gefragt, ich habe geantwortet.
        Wenn Sie die Antwort nicht verstehen wollen, ist das ja schon die ihre Sache, aber wenn Sie beleidigend sein wollen? OK, ist ja auch ihre Sache!
        🙁

      • fufi sagt:

        @Globe und Orlando

        Zunächst: Sollte eigentlich „MIGROS“-Kurs heissen
        (an Klubschule: Check an die übliche Adresse schicken – Danke!)
        😉

        Hab das Motto vom Philosophen Bertrand Russel geliehen, seines Zeichens KEIN Christ – hat sogar ein Buch mit dem Titel „Warum ich kein Christ bin“ veröffentlicht – aber in Fachkreisen als hervorragender Erkenntnisthoeretiker gilt. Er schreibt:
        „Für gewöhnlich halten wir viele Dinge für sicher und gewiss, an denen bei näherem Zusehen so viele Widersprüche sichtbar werden, dass wir lange nachdenken müssen, bevor wir wissen, was wir glauben dürfen.“ (Zitiert nach: B.Russel: Probleme der Philosophie, edition suhrkamp, Suhrkamp Verlag, S.9)

        ——————————
        @globe: Zumindest an den Unis Züri und Basel (hier kann ich’s belegen) kommt nichts, was Theologie studiert, an der geistigen Auseinandersetzung mit der Erkenntnistheorie vorbei – Stichworte: Philosophiegeschichte und Dogmengeschichte) – und ich bin sicher, dass das auch für andere Unis gilt, an denen Theologie als „Wissenschaft“ gelehrt wird.
        Wie das an sogenannt „freien“ oder gar „privaten“ Theologischen-Universitäten aussehen mag? Kann’s nicht beurteilen, aber bin da auch skeptisch!
        ——————————–

        Ich möchte deshalb am liebsten fordern, dass „Erkenntnistheorie“ als Pflichtfach zu JEDEM STUDIUM eigeführt würde!

        Ich möchte hier einfach auch mal sagen, dass ich wenn kein verhinderter, so doch ein verkappter Naturwissenschafter bin. Mein erstes Studium, das ich dann leider aus mehreren Gründen abbrechen musste, war Physik.
        ———————————-
        Die Anekdote, die ich im Altersheim erzählen würde lautet: Es war im WK vom Zivilschutz, als mich einer blöd anquatschte, wie „man denn noch Theologie studieren könne, nach der Relativitätstheorie“. Ich fragte ihn, was denn die RT bedeute, worauf er meinte: „alles ist relativ“. Soso? Ich hab ihm dann die Grundbegriffe der sRT und der aRT und so erklärt. Und etwa 50 Zivilschützer haben interessiert zugehört. Naja, wenn der Kerl kein ZS-Gwändli angehabt hätte, wäre er glaub recht blutt dagestanden!
        ————————————–
        Habe nämlich ein ziemlich grosses Wissen um diverse naturwissenschaftliche Themen, so von Astrophysik bis Zytologie.

        Gerade deshalb erlaube ich mir auch immer wieder, auf die erkenntnistheoretischen Grundlagen auch und gerade der NW, bzw. auf deren Probleme hinzuweisen, so zum Beispiel:
        Am einfachsten: Wir sehen und machen dementsprechende Erfahrungen, etwa, dass ein Apfel vom Baum nach unten fällt. SEHEN wir das wirklich? Tatsache ist, dass das, was unsere Augen registrieren, eine Welt ist, die sozusagen Kopf steht. Heisst: Die AUGEN SEHEN den Apfel nach oben „fallen“. Es ist das „Hirn“, das diese „Augen-Erfahrung“ sozusagen „andersrum“ interpretiert und erst in der korrigierten Version ins „Bewusstsein“ schickt!
        Wir messen – sagen wir – ein Magnetfeld. Das heisst: Wir bringen gewisse Geräte in eine bestimmte Anordnung und „erfahren“ einen „diskreten“ Ausschlag des analogen Messgerätes. WISSEN wir darüber irgendwas über „das Magnetfeld“? Ja klar: wenn dieses SO ist, macht das andere SO, Klaro?
        Zur Genetik: NIEMAND hat je ein DNA-Basenpaar gesehen! Sondern bloss irgendwelche Abfolgen von Zeichen oder Farben am PC oder früher auf irgendwelchen anderen Medien.

        Heisst letztlich: Wir wissen NICHTS über das „Grundgelegte“! Aber wir können „andere“ – weniger fundamentale – Daten vergleichen und sogar so mit „Grundgelegtem“ umgehen, dass „es“ funktioniert.
        Und noch was zur Genetik: Die erste geklonte Katze „Copycat“ hat GANZ anders ausgesehen als diejenige Mieze, von der sie ihr genetisches Material erhalten hat. Das ist durch sogenannt „epigenetische“ Faktoren bedingt, was im Fall von (Katzen)Weibchen die Kombination von Doppel-X-Chromosomen bedeutet, die nämlich die Fellfarbe definieren und von denen in einem bestimmten Empryonalstadium je nachdem und vollkommen zufälligerweise entweder das eine oder das andere Chromosom stillgelegt wird.

        Weshalb ich das alles schreibe?
        Weil es mich manchmal echt anscheisst, wenn gewisse Personen meinen, mich bloss deshalb angreifen zu dürfen, weil ich mich als Theologen geoutet habe und mir damit eine – gelinde gesagt – bloss verminderte intellektuelle Wahrnehmungsfähigkeit attestieren.

        Ich mute mir nämlich zu, zu wissen, wovon ich spreche und schreibe!
        😛

        An globe und Orlando:
        Habe mir Mühe gegeben mit meiner Antwort!
        Erwarte gerne die eure!

      • fufi sagt:

        @Orlando

        Gebe Ihnen gerne „was Brauchbares“ zum Christentum.
        Bedinge mir aber vorher zumindest eine „wohlwollend-akzeptierende“ Haltung mir gegenüber aus.
        Bin zu alt für Sandkastenkriege!
        🙁

      • Globetrotterin sagt:

        Also, Orlando. Jetzt muss also Ihre Weisheit herhalten. Ich warte.

      • Globetrotterin sagt:

        P.S.: an Orlando:
        Bitte nicht in Latein! Ich hab‘ zwar auch mal Latein gelernt, aber das ist lange her…

      • Globetrotterin sagt:

        @fufi:
        DANKE! Ich anerkenne all Ihr Wissen und schätze es, dass Sie sich hier Zeit genommen (und Orlando wohl aus einer grossen Verlegenheit geholfen) haben. Was ich aber nicht verstehe ist, wieso mich das von der Existenz eines Gottes überzeugen soll. Nur weil wir gewisse Ding (noch) nicht verstehen, heisst das noch lange nicht, dass diese von einem „Gott“ geschaffen wurden. Früher glaubten die Menschen an einen Donnergott – seit wir wissen, wie Donner zustande kommt, brauchen wir keinen Donnergott mehr. Und so wird es uns in der Zukunft mit vielen anderen Dingen ebenfalls ergehen.

      • interim placeholder sagt:

        impressing fufi

      • fufi sagt:

        @Globetrotterin
        Danke, auch für ihr Kompliment!
        Wo Sie mich falsch verstehen: Ich habe nicht die geringste Absicht, Sie von der Existenz irgendeines Gottes überzeugen zu wollen! Das KANN ich nämlich nicht, auch wenn ich es wollen täte!
        🙂
        Mir geht’s vielmehr darum, dass ich mich nicht blöd anquatschen mag, bloss weil ich „an Gott glaube“. Das macht mich nämlich nicht automatisch zu einem schlechteren Menschen. Und heisst auch nicht unbedingt, dass ich mich von „der realen Welt“ verabschiedet hätte.
        Oder so!
        😛

      • Globetrotterin sagt:

        @fufi:
        Um Himmels (oder Gottes) Willen: Nichts liegt mir ferner, als Sie (oder irgend Jemanden sonst) als „schlechten Menschen“ zu bezeichnen, weil er/sie an Gott glaubt. Die Diskussion, um die es hier geht, ist doch „Soll Gott von der Schule fliegen?“. Und da finde ich ganz eindeutig: JA! – Ein Gott ist nicht beweisbar, folglich darf man Kindern, die noch nicht in der Lage sind, sich darüber ein eigenes Urteil zu bilden, einreden, dass ein solcher Gott real existiert. Das finde ich unverantwortlich!

      • Globetrotterin sagt:

        Sollte natürlich heissen „NICHT einreden…“.

      • Orlando S. sagt:

        also, während andere den ganzen Nachmittag im Bl0g vertrödeln, verbringen andere einen schönen Samstagnachmittag mit den Kleinen, füttern di Enten udn Schwäne (und Möven erst!) am Bellevue und liest ihnen Geschichten vor.

        @Globetrottelin: Meine Haltung entspricht genau ihrer – Religion hat im Schulunterricht nichts verloren. Aber das hat mit einer gänzlich anderen Auffassung davon zu tun, wozu Schule überhaupt da sein soll.

        @Fufi: Ich wäre dann wohl jener Zivilschützer gewesen, der freche und unbequeme Fragen gestellt hätte und nicht von ihrer Wortgewalt geblendet gewesen wäre (die mündlich bestimmt charismatischer rüberkommt als schriftlich, erhlich gesagt…). Wahrscheinlicher ist jedoch, dass ich die Mitzivilschützer überzeugt hätte, das zu tun, was man im Zivilschutz tun soll: Bier trinken und über Wiiber schnörre. 🙂

        Bin etwas enttäuscht von ihrem Discours. Erkenntnistheorie und so weiter, ja und amen, wird ja mittlerweile nicht nur in der universitären Theologie bis zum Umfallen betrieben, sondern auch in Philosophie, Publizistik, Politologie, etc.etc. GOTT bewahre, dass man sich da mit Ideen auseinandersetzt, bloss nicht! Da könnte man ja auf Ideen kommen…Lieber brav Systemtheorie üben, bis der akademische Geist dermassen erschlafft ist, dass Querulanz und erfrischende Irritationen keine Chance mehr haben.

        Item, ist ja alles rasend spannend, aber was zur Hölle hat es mit dem Christentum zu tun?

        Ich hatte eine einfache Frage gestellt (nein sie lautete nicht, mir „etwas“ über das Christentum zu erzählen. Denn das Christentum ist in diesem Zusammenhang schon ein bisschen mehr als Lebenshilfe für Dummies von Dummies…pun intended 😉

        Sie haben sich neulich vor Schreck fast in den Zivilschutzdress gemacht, als ich die Worte „Heiland“, „Erlösung am Kreuz“ und – horribile dictu! (@Globine: das heisst „wie schrecklich zu sagen“) – „Kreuzzüge“ gelassen ausprach.

        Ich mache das nun systematisch: den Kleinen die biblischen Geschichten näherzubringen. In meinem Elternhaus gabs das nicht. Nur soviel: als ich eine Kinderbuchversion von der Adam- und Eva-Geschichte den Kleinen vorgelesen habe heute morgen, habe ich selber in 20 Minuten mehr über die Bibel und das Christentum erfahren, sind mir wiedermal mehr Lichter aufgegangen, als – wie ich vermute – Ihnen in ihren ganzen Seminarjahren.

        Nur so eine Vermutung. Aber ich bin SEHR gerne bereit, ihnen den Respekt entgegenzubringen, den sie für ihre Ausführungen benötigen.
        Danke!

      • fufi sagt:

        @Orlando

        Es gibt welche, die weder Kinder haben noch in einer Stadt mit Bellevue am See hausen. Einige davon machen morgens einen langen Arbeits-, Spiel- und Spaziergang mit dem Hundi – durch die verschneiten Wiesen, Wälder, Hügel und Täler, die’s dort, wo sie LEBEN nämli noch gibt.
        Wiederum einige davon setzen sich Nachmittag an den PC, geniessen das zufriedene Schnurren der Katzen, die sich NEBEN der Tastatur installiert haben, das ebenso zufriedene Schnarchen des Hundis auf dem Teppich und das fröhliche Klappern des Geschirrs, wenn das Hausmütterchen abwäscht und danach das Abendessen zubereitet (ACHTUNG: ir-gendwas davon ist gelogen!) und schreiben im Mamablog.
        Idyllisch? – meinetwegen, so geschehen?JA! (Kann das Cheminée leider nicht auch noch erwähnen, weil NICHT im gleichen Raum wie der PC *grins*)

        Dass SIE der besagte Zivilschützer gewesen wären, muss ich Ihnen leider glauben!
        Hab absolut nichts gegen Quer- und Kreativdenken, aber wer sich OHNE die zugrundeliegenden Fachkenntnnisse ganz einfach darin gefällt, „Querulanz und erfrischende Irritationen“ von sich zu geben, müsste eigentlich den Kindergarten wiederholen!
        Und dass ein ernsthaftes(!) erkenntnistheoretisches Nachdenken immer und vor allem auch dazu führt, eigene Positionen stets von Neuem zu hinterfragen, dürfte Ihnen auch entgangen sein?

        Ins ZS-Gwändli kann ich leider nicht mehr machen, das hat meine Frau nämlich beim letzten „Zügeln“ zusammen mit ein paar weiteren Uebergwändli der Altkleidersammlung anvertraut. Hat mich rund Fr. 150.- gekostet, darunter 2 „Achselpatten aus Plastik“ zu je Fr. 1.50.
        Unterdessen hat mich dieser Verein leider endgültig ausgeschlossen – trotz bestem Dank für meine geleisteten Dienste.

        Freue mich aber sehr, wenn Sie in 20 Minuten aus der Kinderbibel so viel lernen dürfen.

        Hoffentlich schmecken Ihnen meine Perlen!
        En Guete – Sunntig!

      • fufi sagt:

        @Globetrotterin, am 22. Januar 2011 um 20:47

        Was die „Kernfrage“ betrifft bin ich mit dir einer Meinung!
        „Gott“ im Sinne eines (NICHT NUR christlichen) Religionsunterrichts gehört nicht als „Pflichtfach“ an die Schule.

        Aber jetzt wirds kompliziert, denn:

        a) wie wär’s als Freifach?
        stattlich -sorry: staatlich bezahlte Lehrpersonen, ebensolche Schulungsräume? und das für ALLE Religionen? Oder nur für einige auserwählte?
        🙁

        b) Einführung in die Philosofiegeschichte, wie M.B. vorschlägt?
        da bin ich leider ziemlich skeptisch:
        Plato for Kids? with Socrates‘ Drinks?
        Ich denke also bin ich – bin ich also nicht, wenn ich NICHT denke?
        Ich in der Höhle und Achill mit der Schildkröte?
        pantha rhei – bloss nicht auf dem Zürisee?
        Fröhliches Neinsagen mit Nietzsche?
        undsoweiter!

        c) und wie sollen die achsohäufig beschworenen „christlich-abendländischen Werte“ vermittelt werden, ohne dabei Bezug auf „christliche“ und also „religiöse“ Traditionen zu nehmen?

        Möchte Hier wieder mal daran erinnern, dass sowohl das „christliche“ als auch das „abendländische“ Denken seine GENUINEN WURZELN im (heutigen) türkisch-syrisch-israelopalästinischen Raum hat!

        OMG

        😀

      • Orlando S. sagt:

        @fufi: „Wie halten Sie’s mit der ‚Erlösung am Kreuze‘?“

        Es gibt offenbar Fragen, die so einfach sind, dass zu einer verständlichen und klaren Antwort Ihnen ihre „zugrundeliegenden Fachkenntnisse“ eher im Weg stehen…!? Tatsächlich bin ich KEIN Theologe. Deshalb erlaube ich mir, mit Lust das geschlossene System – in dem sie erkenntnistheoretische Monologe halten, während die Katze schnurrt – zu irritieren und mit ganz simplen Fragestellungen aufzuscheuchen.

        Sie können mich auch einfach bitten, das zu unterlassen und sie in Frieden zu lassen, wenn es sie so derangiert.

        Sonst sitze jeder als „Experte“ in seinem angestammten „Fachgebiet“ und führe selbstreferentielle Diskurse. Hier in diesem offenen Forum sollte doch aber so etwas wie ein Dialog möglich sein, der sich nicht darauf beschränkt „Sie haben sich nicht ernsthaft damit auseinandergesetzt“, „sie sind ein Dummie“, „sie verstehen gar nichts und dürfen darum nicht mitreden“ etc…oder irre ich mich da?

        Ausweichmanöver gescheitert! 😉

        respectfully,
        Orlando

      • mila sagt:

        wirklich, orlando, sie überschätzen sich, wenn sie glauben, dass sie fufi auch nur ansatzweise irritieren (da hab ich doch recht, fufi?). ich würde es sehr begrüssen, wenn sie das bei mir schaffen würden – wirklich, ich bin für sehr vieles offen -, aber dafür sonnen sie sich leider viel zu sehr im lichte ihrer selbstgezimmerten wahrheiten.

      • fufi sagt:

        @ mila
        😛

      • fufi sagt:

        OK, Orlando!

        Irgendwo hat Jesus gesagt, er sei nicht zu den Gerechten gekommen, sondern zu denjenigen, die ihn wirklich brauchen täten. Oder so. Bibelstelle in Vulgata bitte selbst nachschlagen! Vielleicht bin ich gerade deshalb NICHT Gemeindepfarrer geworden?

        Ich glaube, ich habe in diesem Blog noch niemanden einfach so blöd angepisst, mit – gemäss Ihren Worten:
        „“Sie haben sich nicht ernsthaft damit auseinandergesetzt”, “sie sind ein Dummie”, “sie verstehen gar nichts und dürfen darum nicht mitreden” etc“
        Oh ja, ich habe mich gewehrt (und werde das auch weiterhin tun!) gegen irgendwelche, die meinten und z.T immer noch meinen, sie könnten mich, bloss weil ich Theologe bin, in irgendeine mit „Vollidioten“ beschriftete Schublade stecken, und mich entsprechend anmachen.
        Und ja, ich BIN bösartig gegenüber solchen, die meinen, ihr Halbwissen genüge, um mich zur Sau zu machen – eben zum Beispiel betreffend der Relativitätstheorie: „Alles ist relativ“ – „Relativ zu WAS?“ – „Hä????“ – na eben!

        So und jetzt zur Frage nach „der Erlösung am Kreuze“.
        Also, ich glaube NICHT, dass wir Menschen erst und einzig durch den Tod dieses Jesus am Kreuz erlöst wurden/sind/wasauchimmer. Abraham hat Isaak NICHT töten müssen, oder so!
        Bitte KEINE Blutopfer im Namen von Religionen oder Nationen!
        Ich GLAUBE, dass der Kreuzestod, den dieser Jesus – qua „Gottes Sohn“ erlitten hat, ein Zeichen des LIEBEN Gottes an uns Menschen ist, wie sehr er uns liebt – was IMMER DAS denn auch wieder heissen mag, besonders mit Blick auf die aktuellen Weltgeschehnisse!
        Andersrum: In diesem Menschen Jesus hat sich tatsächlich Gott geoffenbart, und zwar so, wie wir Menschen das auch verstehen können!
        Und genau das immer wieder von neuem und dann gerade nochmals darüber nachzudenken ist der Inhalt der Theologie!

        Und dass wir Menschen jede, aber auch wirklich jede physische, psychische oder spirituelle Entdeckung zum Schlechten und kriegerischen einsetzen können UND DAS AUCH TUN!, das ist ja wirklich nichts neues, Oder?

        Neinei, O.S.
        Ich brauch definitiv keinen Streit mit ihnen!
        Falls das für Sie denn so wichtig sein möchte?
        Ansonsten – eben!
        😀

      • Orlando S. sagt:

        @fufi

        habe ihren 14.41 erst jetzt gesehen.
        Das hat wenigstens mal Hand und Fuss!
        Werde darüber nachdenken.

      • Globetrotterin sagt:

        Uff! Hoffentlich habe ich jetzt hier den richtigen Antwortbutton erwischt. Jedenfalls soll das hier an fufi gehen als Antwort auf seinen Kommentar an mich von 12:23, den ich erst jetzt entdeckt habe.
        Religion – wie auch immer eingefärbt – hat ganz einfach an einer Schule nichts zu suchen! Das Wort „Gott“ oder „Götter“ und von mir aus gerne auch „Göttin“ gehört dort ganz einfach nicht hin! Jedenfalls nicht, solange es sich um „heutige“ Götter handelt. Bei der griechischen Mythologie lasse ich vielleicht noch mit mir reden, sofern klar gemacht wird, dass diese in den Bereich „Märchen, Sagen und Legenden“ gehört.

    • Pippi Langstrumpf sagt:

      Mila 🙂

      • Orlando S. sagt:

        Haha, wie feige, die Reihen schliessen sich. Müssen sie auch, es ist gar nicht so einfach, bei meiner Wortmächtigkeit zu bestehen, gell. Kleiner Gratistipp: versuchen sie’s doch mit Mobbing!

      • fufi sagt:

        jaja, zum glück gibt’s unter all diesen Feiglingen noch den guten alten orlando.
        wer sonst möchte die welt doch noch im Griff haben! (AARRGGGHH!)

      • Pippi Langstrumpf sagt:

        Wir sind uns bloss einig, dass du ein Armleuchter bist, Furioso, dazu müssen wir die Reihen nicht schliessen. Keine Gefahr!

      • Orlando S. sagt:

        @fufi: leiden sie unter dem Tourette-Syndrom? Oder haben sie grad den himmlischen Vater um Hülfe gerufen, dass der ihnen den Orly vom Hals halte, der doch den Russell nicht gelesen hat und folglich keinen Dunst hat?

        Wenn sie wirklich fähig wären, den eigenen Standpunkt stets aufs neue zu hinterfragen, denken sie über Orlandos Fragen doch mal bei einem „Arbeitsspaziergang“ im Schnee nach. Ist gesund und gratis.

        Währenddessen lese ich in dem schönen Buch über die Kreuzzüge weiter. Deus lo vult! 🙂

      • mila sagt:

        @pippi und fufi: lieber lasse ich mich – in guter gesellschaft – als feige titulieren, als dass ich mir regelmässig anhören muss: „du redest viel und sagst doch (wenig bis) nichts.“ (wobei, orlando sagt mir das ja ständig). aber eigentlich wollte ich ihn ja in ruhe lassen, ich glaube nämlich nicht, dass er so ein schaumschläger ist, wie er es uns gerne glauben machen würde… aber so ist es halt mit den guten vorsätzen, da braucht es immer mehrere anläufe, bis es funktioniert.

      • fufi sagt:

        @Orlando

        Danke für Ihre Nachfrage, leide aber meines Wissens unter keinen extrapyramidalen Hyperkinesien!
        Höchstens – wenn denn schon – unter Menschen wie Ihnen, die NICHTS verstehen und noch weniger irgendwelche gemachte Fehler oder so zugeben wollen.
        Weiss schon: „Entschuldigung“ und „Danke“ sind die schwierigsten deutschen Wörter, auch für Muttersprachige!

        Und was das Nachdenken über Orlandos Fragen betrifft:
        Nüt für unguet, aber isch theologisch nöd würkli so schaurig neu. Studienmässiger Standard, sozusagen.
        Was nicht heisst, dass das für so einen Orlando nicht wichtig sein soll.
        Bloss möchte sich ein söttiger Orlando mit einer (Geistes)Haltung an einen Theologen wenden, wie er das zum Beispiel beim Zahnarzt oder der Steuerberaterin auch tut.
        🙁

      • Globetrotterin sagt:

        Warum tun wir alle uns diesen Orlando überhaupt an?! Asche zu Asche – Staub zu Staub – tausend Rosen für die Ewigkeit. Und damit hat’s sich.

      • Pippi Langstrumpf sagt:

        Ja, so weit waren wir auch schon mal, kein Futter für den Troll!

        Und Globe, SKLAVINNENMENTALITÄT, klar. Wahrscheinlich geht es mir so gegen den Strich, dass Frauen Sklavinnen sein können, dass ich das Wort nicht mal schreiben mag….. 😛

      • Orlando S. sagt:

        @fufi

        ich meinte ihr AAAARRRGH. Wahrscheinlich hervorgerufen weil phöse pöhse Orlando nüt verstah, von gar NICHTS.

        Ich sehr dumm, fufi, nix wissen wenn mir nicht sagen du.

        Oje, ich habe mich schwer getäuscht in ihnen, fufi. Gestern, mit einem drei- und einem fünfjährigen Buben, erlebte ich keine solchen kindlichen Trotzhaltungen wie von ihnen jetzt. Sie sind es sich offenbar gewohnt, dass sie dozieren und die anderen ergeben lauschen. Sie arbeiten in einem Job wo sie vor allem mit Frauen zu tun haben, gell? Da ist es natürlich irritierend, wenn mal ein Mann kommt und mit lauter Stimme zu ihnen spricht.

      • Globetrotterin sagt:

        Nichts als Provokation. Wer drauf rein fällt ist selber schuld.

      • fufi sagt:

        @Orlando

        so wegen „Trotzhaltung“ erlaube ich mir, Sie zu zitieren mit:
        ———————————–
        „weil phöse pöhse Orlando nüt verstah, von gar NICHTS.

        Ich sehr dumm, fufi, nix wissen wenn mir nicht sagen du.“
        ——————————————–
        Und wenn Zahlen weiblich wären, hätt ich’s im Job schon vor allem mit Frauen zu tun!
        😛

      • Orlando S. sagt:

        Läck fufi, sind sie ein Höseler!

        Ich ärgere mich gerade dass ich von einem notorischen Dummschwätzer tatsächlich mehr erwartet hatte, als dummes Geschwätz. Was sie da 14.41 verzapfen, taugt nicht einmal für eine laue, landeskirchliche Sonntagsschule. Ich meine, zeitgeistiges Geschwafel wie: „ich GLAUBE, dass der Kreuzestod, den dieser Jesus – qua „Gottes Sohn“ erlitten hat, ein Zeichen des LIEBEN Gottes an uns Menschen ist, wie sehr er uns liebt – was IMMER DAS denn auch wieder heissen mag, besonders mit Blick auf die aktuellen Weltgeschehnisse!“ kann nicht einmal jemand Ernst nehmen, wer ihnen wohlwollend gegenüberstünde.

        „Nüt für unguet, aber isch theologisch nöd würkli so schaurig neu. Studienmässiger Standard, sozusagen.
        Was nicht heisst, dass das für so einen Orlando nicht wichtig sein soll.“

        Die Überheblichkeit, die aus diesen Zeilen spricht, entlarvt sie als einen der ganz intoleranten Sorte. Was Wunder, dass sie zu konzisen Aussagen über theologische Inhalte NICHT fähig sind.

        What a waste of time!

      • fufi sagt:

        Es wurde geschrieben im Mamablog:
        —————————————-
        Orlando S. sagt:
        23. Januar 2011 um 15:56
        @fufi

        habe ihren 14.41 erst jetzt gesehen.
        Das hat wenigstens mal Hand und Fuss!
        Werde darüber nachdenken.
        ——————————————-
        Orlando S. sagt:
        23. Januar 2011 um 23:53
        Läck fufi, sind sie ein Höseler!

        Ich ärgere mich gerade dass ich von einem notorischen Dummschwätzer tatsächlich mehr erwartet hatte, als dummes Geschwätz. Was sie da 14.41 verzapfen, taugt nicht einmal für eine laue, landeskirchliche Sonntagsschule.
        ——————————————-

        Und was lernen wir daraus?

        Il ne faut pas confondre Monsieur O. et Monsieur 0.
        ;P

  • Libertin sagt:

    Mir wäre eine Mutter lieber. 😀

    • Globetrotterin sagt:

      Warum wohl reden wir von „Mutter Natur“ und „Mutter Erde“? – Das aber kann das Patriarchat nicht verkraften. Deshalb muss ein „Vater-Gott“ her! Religionen SIND das Patriarchat!

      • tobe or not tobe sagt:

        @Globetrotterin: Wer kann, nach ansicht der Kirche, Leben schenken? Das ist ihr Gott… Doch wer kann es auch noch? Ihr Frauen! Gib dir zu 100 % Recht.. Das Patriarchat der monotheistischen Religionen ist eine Flucht vor der eigenen Existenzgrundlage.. Die Geburt eines jeden Kindes durch eine Frau und nicht den Mann.

        Was Gott ist? sicherlich kein Mensch… (behaupte ich mal eben so) wir könen noch nicht oder nicht mehr in solchen Dimensionen die Welt wahrnehmen. Die Intuition wird uns nach und nach geklaut, durch die vermeintiche „vereinfachung“ des Lebens. Schon durch die Elektronik werden unser Gehirn bzw. Nervenströme stimuliert…

      • Globetrotterin sagt:

        @tobe:
        Ah, es tut gut, in dieser Frage selbst mal von einem Mann unterstützt zu werden. Ich will ja nicht unbedingt die Frauen über die Männer stellen, aber diese jahrtausendelange, nach wie vor anhaltende, systematische Unterdrückung der Frau ist ein Verbrechen, für das sich die Kirche, sollte sie denn noch eine Zukunft haben, irgendwann einmal wird verantworten müssen. Und dann werden, wie gewohnt, die Verteidiger wieder sagen, „man kann ja nicht die heutige Kirche für die Vergangenheit verantwortlich machen“. So, wie man das heute mit den Hexenverbrennungen, der Inquisition, dem Sklavenhandels, der Kriegstreibereien, dem Kindsmissbrauchs, der Kolonialisierung, etc., etc. macht. Gunnar Heinsohn hat kürzlich im ZDF-Nachtstudio (9. Jan. 2011) einen neuen Begriff geprägt, nämlich den der „Christianisten“, analog zu den Islamisten. Auch wenn wir uns das noch so lange einreden, wir sind und waren keinen Deut besser, wenn nicht sogar schlimmer. Erst wenn wir diese monotheistischen Religionen allesamt ad acta gelegt und „zum Teufel“ gejagt haben werden, haben wir vielleicht eine Chance auf eine bessere Welt.

        Auch mit Deinem zweiten Absatz bin ich voll und ganz einverstanden. Intuition wird uns wahrhaftig – wie Du es so treffend formulierst – nach und nach geklaut. Und sie wird ins Lächerliche gezogen, so dass wir uns nicht einmal mehr trauen, unseren Intuitionen zu folgen. Welche Frau wurde nicht schon verhöhnt wegen ihrer „weiblichen Intuitionen“? Ihr, die ihr sie noch habt, gebt sie nicht preis – folgt ihnen!

      • tobe or not tobe sagt:

        @Globetrotterin: Ich sehe als Mann kein Grund, die Stellung der Frauen innerhalb der Menschheit zu verneinen, im Gegenteil, ich behandle auch meine Partnerin gleichwertig. Ich möchte weder Mannn noch Frau anbeten. Aber wie du schon gesagt hast, es heist MUTTER NATUR aus deren Schoss auch ich entsprang.

        Als Katholik erzogen, habe ich einen tiefen Einblick in die Christenwelt erhalten.. habe mich dann auch stark mit meinem Glauben auseinandergesetzt und bin auf den ähnlichen Schluss wie du gekommen:

        Solange monotheistische Religionen existent sind und in die Köpfe reiner Kinderseelen initiert wird, wird die Welt sich nicht vorwärtsbewegen. Nein wie du siehst haben wir uns zurückgedreht, wie im tiefsten Mittelalter, ist es wieder wichtig wessen Religion du angehörst.

        Auch mit dem islam hab ich mich auseinandergesetzt und obwohl es so ist, das manche Fanatiker ihre Frauen stark unterdrücken, ist aber die Stellung der Frau innerhalb eines Familiennetzes sehr wichtig angesehen. Was ich im Christentum sehr vermisse. Man redet von nächstenliebe unsd steckt die Oma ins Altersheim (natürlich auch begleiterscheinung des Luxus) Aber auch diese monotheistische Religion zwingt Menschen dazu, nicht ihrer Intuition zu folgen, sonder einem Gott der dir Vorschreibt was richtig und falsch ist.

        Ich bin froh das es weltweit junge Muslime gibt die sich reformieren, … ihren Glauben der Zeit anpassen.

        Aber all diese Leute, die sich so christlich aufführen, geben mir keinen Respekt mehr, weil ich ihren Gott kritisiere? Und sprechen im gleichen Atemzug von Christenliebe und welch grosse Hilfswerke die Kirche ja überall aufbaut…

        Wären sie so gläubige Christen wie sie behaupten, würde diese Gesellschaft auch in der Schweiz freundlicher sein. Den auch andersgläubige sollst du akzeptieren, wie deine eigenen Geschwister..

        Viel blabla von mir gerade, aber des Thema Intuition und geistige Fähigkeiten, wir immer wieder ins lächerliche Gezogen. Wenn ich als Mann im Alltag davon spreche, werde ich ziemlich komisch angesehen. Man unterstellt mir ja indirekt einen psychischen Schaden, weil ich ausspreche was jeder in sich fühlt, aber nicht akzeptieren will.. Denn auch ein Mann hat diese Fähigkeiten.
        Deshalb flüchten die sich in die materielle Welt, den für die Geistige haben wir keine Anleitung erhalten, fürs I-phone schon…

      • Brunhild Steiner sagt:

        @tobe or not tobe: was genau meinen Sie wenn Sie von „der Kirche“ sprechen? Die katholische Institution?
        Wissen Sie dass in anderen kirchlichen Organisationsformen auch Frauen als Bischöfinnen amtieren?
        Und dies erst noch ohne über ihnen stehenden Papst?
        Haben Sie durchs Band nur und ausschliesslich negative Erfahrungen gemacht?
        Und mit allen Menschen, Institutionen, Organisationen, Bewegungen welche explizit zu jeder Form von „Religiosität und/oder Tranzsparenz“ Distanz halten, ausschliesslich nur gute?

        Geprägt werden „die reinen Kinderseelen“ so oder so.
        Ist es nicht ein breites Band von “prägen” bis zu “indokrinieren, Hirnwäsche und die Seele verschmutzen”?
        Und, gehen Sie auch mit demselben Eifer gegen andere, nicht weniger bedenkliche Prägungen aus der weiten Medien-und Konsumwelt vor, wo auch schon kleine Kinder auf bestimmte Verhaltensweisen fast schon “konditioniert” werden?

        Es liegt an den Erwachsenen diese Prägung, aus welcher Ecke nun auch immer, so vorzunehemen dass nie eine Indoktrination stattfindet und sich das Kind auch davon lösen dürfte. Wenn aber diese Freiheit grundsätzlich zugestanden wird, sehe ich keine Probleme. Im Gegenteil, mit meinen Kindern erlebe ich Dimensionen welche ich nie für möglich gehalten hätte, sie kommen zu Schlussfolgerungen, Erkenntnissen, Wahrheiten welche ich nicht einfach vorgebetet haben, sondern welche sie sich, in Auseinandersetzung mit “Transzendenz” selber erarbeitet haben. Und die sich in ihrem Alltag, in unserem Leben ganz greifbar auswirken, fassbar sind.
        Hätte ich ihnen aber nicht von Anfang an das “Ausgangsmaterial” zur Verfügung gestellt,
        dann wären sie heute um viele Erfahrungen ärmer. Und ich übrigens auch.

      • Brunhild Steiner sagt:

        @tobe or not tobe: Was genau meinen Sie mit „der Kirche“? Die katholische Institution? Ist Ihnen bekannt dass in anderen kirchlichen Institutionen Frauen als Bischöfinnen amten, ohne übergeordneten Papst an der Spitze?
        Haben Sie tatsächlich ausschliesslich negative und destruktive Erfahrungen
        mit „religiös und/oder transparenzinspirierten Menschen“ gemacht?
        Und mit Menschen, Verbänden, Organisationen, Systemen, Bewegungen etc. welche sich explizit von jeglicher Religiösität/Transparenz distanzieren, ausschliesslich gute und konstruktive?

        Was die Prägung der „reinen Kinderseelen“ betrifft, geprägt werden sie so oder so.
        Ist es nicht ein breites Band von “prägen” bis zu “indokrinieren, Hirnwäsche und die Seele verschmutzen”?
        Was ist mit den nicht weniger bedenklichen Prägungen aus der weiten Medien-und Konsumwelt, wo auch schon kleine Kinder auf bestimmte Verhaltensweisen fast schon “konditioniert” werden?

        Es liegt doch an den Erwachsenen diese Prägung, aus welcher Ecke nun auch immer, so vorzunehmen dass nie eine Indoktrination stattfindet und sich das Kind auch davon lösen dürfte. Wenn aber diese Freiheit grundsätzlich zugestanden wird, sehe ich keine unlösbaren Probleme. Im Gegenteil, mit meinen Kindern erlebe ich Dimensionen welche ich nie für möglich gehalten hätte, sie kommen zu Schlussfolgerungen, Erkenntnissen, Wahrheiten welche ich nicht einfach vorgebetet haben, sondern welche sie sich, in Auseinandersetzung mit “Transzendenz” selber erarbeitet haben. Und die sich in ihrem Alltag, in unserem Leben ganz greifbar auswirken, fassbar sind.
        Hätte ich ihnen aber nicht von Anfang an das “Ausgangsmaterial” zur Verfügung gestellt,
        dann wären sie heute um viele Erfahrungen ärmer. Und ich übrigens auch.

        das ist ein zweiter Versuch, falls das Ding doppelt geliefert wird bitt ich um Nachsicht…

      • tobe or not tobe sagt:

        @Brunhild Steiner: Die Kirche als solches erhalten nur noch sich selber und nicht den Glauben. Man kann den Kindern nicht mehr Moral beibringen, während die Welt um sie herum ohne Moral ist.
        Der Grundgedanke des Christentums, mit dem sozialen Gefüge und Verhaltensweisen ist gut und wäre eine sehr gute Gesellschaftsform. Der Glauben an den Gott an sich, kann jeder für sich beanspruchen wie er will….

        Gott oder was sie als solches sehen, braucht keine Verehrung, keine Kirche… sind sie in dem Punkt mit mir einverstanden? Den Respekt an Mutter Natur können wir zollen, indem wir sie respektieren und nicht Paläste bauen…. In jedem Sandkorn ist wohl mehr „gott“ als in einer Kirche. Die Zusammenkunft der Menschen um den „Leib christi“ einzunehmen ist eine Lobpreisung eine vergötterung…

        Ich habe nichts mehr am Hut mit ursprünglichem Glauben, aber bin ganz klar auch beeinflusst, von dieser Denkensrichtung…Es hat mich geprägt auch in positiven Sinnen. Auch heute noch versuche ich die Grundsätze zu leben und nicht zu diskutieren. Die Handlung dahinter ist mir persönlich wichtiger, egal zu welcher Religion du angehörst. Wie auch Christen kenne ich Muslime, die genau gleich „scheinheillig“ sind, doch ihr Glaube nur noch als Tradition weiterführen, nicht als Lebensgrundsatz. Das ist der Unterschied zwischen einem Gläubigen der handelt und einem Angehörigen einer Kirche

        Ja und ich Sage meine Meinung auch zu anderen bedenklichen Prägungen, den auch alle anderen Weltregierungen haben Zerstörung hervorgebracht… Ich möchte aber nie jemand von meinem Gedankengut überzeugen wollen, eher zum Denken anregen, aber die Handlung ist jedermanns/fraus Sache…

        Das Christentum hat sehr gute Richtlinien und Regeln des einfachen Zusammenlebens,

      • Brunhild Steiner sagt:

        @tobe or not tobe (15:45): mit vielem einverstanden…:-)
        die Prinzipien und Gedankenanstösse lassen sich sehr gut auch ausserhalb einer organisierten Form umsetzen, da haben Sie absolut Recht. Und es stimmt auch dass es eine Herausforderung ist den Kindern z.Bsp. Rücksicht im Alltag zu lehren, wenn sie beinahe bei jeder Busfahrt Mühe mit Aussteigen haben weil alles von aussen reindrängt.
        Mir gefällt an der „organisierten Form“ dass ich mich mit Gleichgesinnten treffen kann, wir austauschen können, uns gegenseitig ermutigen oder auch hinterfragen, miteinander und aneinander wachsen und reifen können. Zusammen singen gefällt mir auch, und kommt mich ein bisschen günstiger als wenn ich dafür an verschiedenste Konzerte gehen müsste. Plus die ganzen Hilfestellungen auf die ich in einem Notfall zählen könnte. Von daher erlebe ich organisierte Kirche nicht als inhaltsleere Hülle welche bloss zum Selbstzweck aufrechterhalten wird.
        Aber ich kann sehr gut verstehen dass Sie aufgrund Ihrer Erfahrungen ohne das Ganze leben wollen (und auch können!).

      • fufi sagt:

        @Globe am 21.1.11, 16:48

        Immerhin gilt wenigstes „der Krieg als der Vater aller Dinge“.
        S’wird aber na komplizierter, wenn gewisse Diktatoren von „der Mutter aller Schlachten“ faseln.
        Versteh’s selbst eigentli au nöd so rächt!
        🙁

    • Globetrotterin sagt:

      Dass heute die Oma (und der Opa) ins Heim gesteckt wird, hat meiner Meinung nach weniger mit Luxus sondern mit Kapitalismus zu tun. Der Kapitalismus ist ein Kind des Patriarchats und konnte sich nur in einem solchen entwickeln. Wir sind und werden dazu abgerichtet, dem Geld hinterher zu rennen. Und dies in einem Ausmass, das uns keine Zeit mehr lässt, darüber nachzudenken, was wir eigentlich tun. Da liegt der Hund begraben. Wir dürfen keine Zeit mehr haben, denn sonst könnten wir diese ganze Idiotie ja am Ende durchschauen. UND DAS MUSS MIT ALLEN MITTELN VERHINDERT WERDEN!

      • Orlando S. sagt:

        Ihre Platte hat einen Sprung! Das ist der Grund, wieso sie immer wieder rausfallen, es heisst stets: „Doppelter Kommentar entdeckt. Das haben sie vermutlich schon mal gesendet“.

      • Jaja, die Frauen, das unschuldige Geschlecht… die haben also zum Gang der Dinge bislang nichts beigetragen, waren nirgendwo inolviert, haben nichts gesagt, nichts getan… so eine Art weisser Fleck auf der Weltkarte der Kulturgeschichte, eine Art Heiligtum, das über allem schwebt wie ein Engel mit weit, weit ausgebreiteten Flügeln, dem Guten zugewandt und nur dem Guten… nur Gutes im Sinne hat, wie zum Beispiel Globi, die Weise, die uns Männer, die Inkarnation des Bösen, Sinnbild von allem Schrecklichen, ver… nichten… äh, sorry, natürlich bekehren will.

        So ein krudes, primitives und verachtenswertes Weltbild ist mir noch selten untergekommen, wirklich. Zum Glück repräsentieren solche Elemente nichts anderes, als sich selbst und ihre verquere Sicht der Dinge.

      • tobe or not tobe sagt:

        @Globetrotterin: Der Kapitalismus ist anti-christlich… Würden die Leute ihren Glauben mit allen Prinzipien Leben, währe wohl nicht jeder 2 Mensch auf der Welt am hungern….Ganz simple aber eindeutige Überlegung…

        @Zuffrey: Hinter jedem mächtigen Mann war schon immer eine Frau. Und wie in jedem Mann schlummert auch in jeder Frau eine böse, dunkle Seite die hervorkommen kann.. . Das ist der Mensch an sich… doch es ist Tatsache, das Religionen patriarchisch sind und die Leistung von Frauen zuwenig Achtung gegeben wird. Zudem wird unser Fähigkeitspotential unterdrück, bewusst, um kein Chaos zu provozieren. Denken Sie nur daran wieviel wir von unserem Hirn wirklich brauchen?¨ Wenige %…

      • @not to be: Womit können Sie belegen dass der Leistung der Frauen zu wenig Achtung entgegengebracht wird? Und seit wann soll der Kapitalismus anti-christlich sein? Ich glaube, Sie vermengen da etwas. Dass die Kirche ein patriarchale Institution ist, tut mir zwar leid, aber als Agnostiker sind mir diese Religionkostrukte sowieso einerlei.

      • Das ist doch eine recht wilde Antwort, not to be. Religion + Kapitalismus = Anti-christliches Patriarchat? Ich glaube, Sie vermengen da etwas. Warum der Leistung von Frauen zu wenig Achtung entgegen gebracht werden soll, entzieht sich meiner Kenntnis. Können Sie das irgendwie belegen, ich meine stichhaltig?

      • Globetrotterin sagt:

        Dieses Teilstück hier habe ich ja noch gar nicht entdeckt!

        Zuerst mal an Zufi:
        Sie sind aber auch wirklich ein gaaanz Lernresistenter! Ich habe Ihnen schon einmal – an einem anderen Ort – eine Liste vorgelegt, weshalb Frauen an den patriarchalen Strukturen des Mannes NICHT mitschuldig sind. Erinnern Sie sich? Oder soll ich Ihnen die Liste nochmals aufschreiben?

      • Globetrotterin sagt:

        Und jetzt @ tobe:
        Ich muss Ihnen ganz energisch widersprechen. Kapitalismus kann NUR unter patriarchalen Voraussetzungen entstehen. Der schreckliche Hunger auf dieser unserer Welt wird künstlich erzeugt und gesteuert (und ist somit ein Verbrechen an der Menschlichkeit!). Er ist das Resultat von Herrschaft, Macht, Gier und Hierarchie, welche wiederum zu den Grundprinzipien des Patriarchats gehören. Und wie wir ja schon wissen: Patriarchat = Religion.
        …und noch was: religiöser Glaube + Prinzipien – das ist ein Widerspruch in sich selbst. Schauen Sie sich doch die christliche Doppelmoral an allen Fronten einmal genau an!

      • Globetrotterin sagt:

        Das glaub‘ ich aber jetzt nicht! Jetzt fragt der Zufi auch noch nach Belegen für die systematische Ausbeutung der Frauen! Sagen Sie mal, Zufi: AUF WELCHEM PLANETEN LEBEN SIE?

      • Pippi Langstrumpf sagt:

        Globe, das musst du dich bei dem nicht mehr fragen, der ist entschuldigt. Einfach ins Leere laufen lassen……

      • Katharina sagt:

        „AUF WELCHEM PLANETEN LEBEN SIE“

        omega coda centauri?

      • tobe or not tobe sagt:

        @Globetrotterin: Ich meinte der grundsätzliche Christliche glauben, wie wir ihn Leben sollten, nicht wie er heute praktiziert und ganz klar zu kapitalistischen Zwecken ausgenützt wird. Der ANTI-CHRIST IST IM VATIKAN, wenn wir eine Verköperung nach biblischem Wissen, des Teufels bestimmen möchten..

        Also der Kapitalismus ist klar eine Sache des patriarchats als ergo auch der monotheistischen Religionen. Der Anti-christ den sie sogern in andern sehen, steckt in denen, so wollte ichs wohl ausdrücken…komplizierte Sache, hoffe kannst mir folgen 🙂

    • Globetrotterin sagt:

      Schon wieder ist mein Kommentar verschwunden. Die Wahrheit ist offensichtlich zu reaktionär.

      • Globetrotterin sagt:

        Bevor ich es nochmal versuche, warte ich noch ein Weilchen. Es kann doch nicht sein, dass hier nur seichtes Bla,bal veröffentlicht wird. Ich habe in meinem Kommentar weder jemanden angegriffen noch beleidigt. Ich dachte, wir diskutieren hier ernsthaft. Oder ist dieser Blog sowas wie das Vorabend-TV-Programm?

      • Globetrotterin sagt:

        An Red.: DANKE!

      • Auguste sagt:

        hmm…, manchmal frage ich mich, wenn ich diese aufschreie über „verschwundene“, „verspätete“ oder sonst irgendwie „behinderte“ post lese, ob die darin zum ausdruck kommenden befürchtungen nicht eher vom inhalt der selbigen herrühren als von diffusen, redaktionellen hindernissen.

        wie ging das nochmal mit dem gewissen und dem ruhekissen?

      • Brunhild Steiner sagt:

        @Auguste: nein, es ist echt mühsam, soeben ist meine Antwort an Globetrotterin wieder im Zwischennirvana und ich Eselin hab sie nicht abgespeichert. Eine flüssige Diskussion findet so nicht statt und das bedauere ich ebenfalls.

      • Gut, Antwort drei geteilt (hokuspokusverschwindibus, deshalb): To be, Sie vermengen da etwas.

      • Teil 2: To be, Ihrer Ansicht nach ist Religion + Kapitalismus gleich einer Art von antichristlichem Patriarchat? Bemerkenswert!

      • Teil 3: Belegen Sie mir bitte stichhaltig, weshalb weiblicher Leistung heute zu wenig Achtung entgegen gebracht werden soll, danke.

      • Orlando S. sagt:

        @Marcel: vergessen Sie’s. Von solcherart verblendeten Dummparolenschwätzern kriegen sie nie stichhaltige Argumente geliefert. Sachlichkeit und Fakten stören drum das Weltbild, in dem man es sich grad so bequem eingerichtet hat.

      • tobe or not tobe sagt:

        Zufferey Marcel sagt:
        22. Januar 2011 um 19:04
        Teil 2: To be, Ihrer Ansicht nach ist Religion + Kapitalismus gleich einer Art von antichristlichem Patriarchat? Bemerkenswert!

        Man lernt uns Nächstenliebe, die christlichen Werte, währendessen kauf und verkauf der Vatikan Aktien an den Börsen.?? wie wollen sie das rechtfertigen? Hier wird immer wieder von den Hilfsleistungen der Kirche geredet, doch wo sin die geblieben? Wenn ich in der Schweiz obdachlos wäre und in der Kirche unterschlupf suchen würde, wäre keine inzige Kirche geöffnet. Man hat Angst vor Dieben, die evtl. Wertgegenstände klauen.
        Sollen sie doch, was haben wir zu verlieren? Eine Kirche benötigt kein Gold und Edelmetalle. Sind sie mit mir einig?

        Und zum Patriarchat: Die Stellung der Frau innerhalb der katholischen Kirche ist ganz klar zurückgestuft und kommt an 2. Stelle. Bei den reformierten ist es liberaler aber auch dort gehört die Frau an ihren vorgeschriebenen Platz. Der Antichrist sollten sie ja wissen wer gemeint ist. Nach kirchlicher Lehre ist es der Blender, der der uns lockt mit materiellen, weltlichen Gelüsten… Und der Vatikan ist eindeutig ein patriarchisch geleitetes, kapitalistisches System, dass dem Anti-christ fröhnt.. von dieser Meinung bringt mich niemand ab, so verwegen sie auch klingen mag.

        Ein Pabst sollte kein Geld benötigen, Bischöffe sollte keine 150kg auf den Rippen haben, sondern Fasten, den Gläubigen zuliebe.

        Also im gross und ganzen kann ich das alles nicht mehr ernst nehmen und voralllem irgendwelche Rechtfertigungen von „Gläubigen“. Ich schäme mich für diese Kirche und dieser herzlosigkeit die in unserer ach so christlich geprägten Gesellschafft vorherrscht. Die Christen haben hierzulande ihren „Glauben“ widerentdeckt, nachden Anschlägen im September 2001. Jetzt muss sich jeder auf eine seite Stellen und wie ein Hooligan in der Fankurve, für seine „Manschaft bzw. Glauben“ kämpfen.

        Zufferey Marcel sagt:
        22. Januar 2011 um 19:07
        Teil 3: Belegen Sie mir bitte stichhaltig, weshalb weiblicher Leistung heute zu wenig Achtung entgegen gebracht werden soll, danke.

        Wir beginnen in der dunklen Vergangenheit bei Heiligsprechungen+ Hexenverbrennungen und hören auf bei der klaren Stellung der Frau innerhalb der Kirche die noch heute unverändert ist. Ich glaube sie wissen genau, das die Kirche erst im letzten Jahrhundert diese Geschichten begann aufzurollen und sich noch heute schwer tut, den Stellenwert der Frauen zu akzeptieren.

        Vielleicht gehöre ich einfach einer anderen Generation Mensch an, der die Unterschiede zwischen den geschlechtern nicht mehr so stark gewichtet wie meine Eltern etc. es taten. Michzählt der Mensch und seine Taten, nicht seine Worte.

  • tobe or not tobe sagt:

    Gott ist lediglich das Konstrukt der Menschen. Der Mensch wurde bewusst jahrhunderte lang gesteuert und mit dem glauben gelassen, das nicht sie göttliche Fähigkeiten haben sonder nur einer und das ist Gott.

    Wir Menschen hätten Fähigkeiten, die uns selber angst machen würden, doch wir werden alle gezielt geblendet…!!

    Ich frage mich heute immer wieder, wie arrogant der Mensch ist zu behaupten der Gott habe unser Anliz.

    Gott in meinen Augen existiert nicht als Person sonder als immerwährende, allwisende Energie die das ganze Universum einhüllt.

    Wenn sie gut hinhören, hören auch Sie die Weisheiten des Universums die wir tagtäglich abrüfen können. Deshalb beten Leute, deshalb wird meditiert um das Universum zu hören, zu verstehen…

    ist lediglich meine Ansicht aber keine Missionierung. Das muss jeder für sich selber herausfinden.

    • fufi sagt:

      Woher hast du DAS gelernt?

    • Libertin sagt:

      Steht nicht schon in der Bibel: Wer vom Baum der Erkenntnis isst wird sein wie Gott und Gut von Böse unterscheiden können. Darin, in dieser Fähigkeit, ist die „Autonomie“ des Individuums begründet (vom griechischen autonomia: sich selbst Gesetze gebend im Gegensatz zum „göttlichen Gesetz“).

      Der Volksmund sagt dann auch: Wissen ist Macht, macht mich frei. Je mehr ich mich meines eigenen Verstandes bediene umso weniger brauche ich jene, die vorgeben, es an meiner Statt (besser) zu tun.

      Da liegt auch die Trennlinie zwischen Selbst- und Fremdbestimmung. Autarkie und Fremdherrschaft.

      • tobe or not tobe sagt:

        Daher wäre die Bibel, Koran etc weit mehr als wir uns bewusst sind. An Esotherik fehlt es diesen Büchern nicht, genau gelesen ist es eine Wegleitung.

        Daher kein Vorwurf an Gläubige aber: Ihr macht es euch einfach im Leben und macht Gott verwantwortlich für eure Taten und denkensweise. Dies ist Fremdbestimmung und macht es Diktatoren, Extremisten und auch Fanatiker einfacher, eures mangelnde Selbstbewustsein zu unterwandern.

        Selbstbestimmung ist kein einfacher Weg, aber mich hat er erfüllt, erfüllt mit Tatsachen, Wissen und auch mit Leben. Angst ist kein ständiger Begleiter mehr.

        Kirchliche Glaubensstrukturen bewirken meiner Meinung nach nur :

        Angst in die Hölle zu kommen
        Angst die falsche Religion zu haben
        Angst Gott nicht zu fürchten
        Angst davor zu leben…

      • Brunhild Steiner sagt:

        @tobe or not tobe: mir scheint Sie machen da eine falsche Schlussfolgerung,
        nirgendwo wird in der Bibel impliziert man könne die Verantwortung Gott abschieben,
        im Gegenteil, es wird ganz klar Wert auf Selbstverantwortlichkeit gelegt,
        nicht unbedingt alles selber bestimmen wollen, aber selbst verantwortlich sein und sich nicht hinter irgendwelchen Floskeln (oder Büschen) verstecken gehen und jemand anderem die Schuld zuschieben.

      • Globetrotterin sagt:

        Richtig, tobe! Mit der Angst werden wir instrumentalisiert. Der junge Moslem, der im Krieg tötet, hat als Kind auch einmal gelernt, „Du sollst nicht töten“ (ich gehe mal davon aus, dass das auch im Islam so ist). Er tötet aber und muss weiter töten. Sollte er irgendwann doch einmal Skrupel bekommen, wird ihm gesagt: „Allah will, dass Du tötest. Du willst Dich doch nicht gegen Allah stellen?!“ Und so tötet er weiter und gibt die Verantwortung dafür an Allah ab. Bei den Christen war’s genau so!

      • Brunhild Steiner sagt:

        @Gobetrotterin: das sind Sie falsch informiert, in gewissen Gegenden wird den Kindern sehr wohl beigebracht dass es richtig und gut ist die Andersgläubigen zu töten! Und zwar hochoffiziell in der Schule. Das können Sie in Büchern nachlesen in denen Menschen von genausolchen Kindheiten berichten.

      • Globetrotterin sagt:

        @Brunhild Steiner:
        Sag ich doch!

      • Brunhild Steiner sagt:

        @Globetrotterin: Sie haben gesagt:
        „Der junge Moslem, der im Krieg tötet, hat als Kind auch einmal gelernt, “Du sollst nicht töten” (ich gehe mal davon aus, dass das auch im Islam so ist)“
        das hat er eben nicht unbedingt, manchmal lernen diese schon als Kind dass sie das tun sollen weil es richtig ist.
        Und kommen somit eben auch nicht in Konflikt mit Allah, der nun plötzlich etwas zu verlangen scheint was er vorher nicht wollte.

      • StefanB sagt:

        Tobe: nur der Übeltäter muss Gott fürchten. Man soll keine Angst vor Gott haben, sondern ihm voll Respekt gegenübertreten.

      • Globetrotterin sagt:

        @Stefan B.:
        Das ist es wahrscheinlich, weshalb in den Liturgien so oft von „Furcht“ die Rede ist. Die Angstneurosen unter den Klerikern müssen ja fürchterliche Ausmasse angenommen haben.

    • fufi sagt:

      @tobe

      Bin absolut einverstanden, dess es „mehr“ gibt, als viele sich vorstellen können!
      Bin aber noch immer davon überzeugt, dass „unser Vater im Himmel“ – was immer das denn
      genau bedeuten mag, auch dort das „SAGEN“ hat!
      😀

      • tobe or not tobe sagt:

        @Fufi: Ist auch meine Meinung, es ist nicht er oder sie oder es dass das sagen hat, sonder jeder für sich selber!!!

        Gott ist ein konstrukt der Menschheit…… und existiert nur in unseren Köpfen. während wir übersehen, dass wir selber ein Teil dessen sind, was wir Schöpfung nennen.

        @Brunhild Steiner. Die Bibel ja die Bibel würde uns Selbstbestimmung zugestehen, nicht aber die Kirche die uns diesen Glauben eingeprägt hat!! Wer hat die Bibel gelesen und diese wirklich begriffen? Glaube nichtmal der Papst hat die Schriften verstanden, sonder es sind nur interpretationen von Interpretationen.

        ich wünsche der Menschhet ein wenig mehr Bewusstsein…..

  • Libertin sagt:

    „….dennoch befürchten Freidenker, dass ihre Kinder dort vornehmlich religiöse Positionen und Toleranz vermittelt bekommen..“.

    Man gestatte hier den Hinweis darauf, dass gerade in Sachen Toleranz gegenüber Andersdenkenden die Religionen (man lese die Geschichtsbücher und die News) einen etwas schmalen Leistungsausweis präsentieren. Ich erinnere an die „christlichen“ Liebesbezeugungen gegenüber dem Vater in Triengen oder dem Walliser Lehrer, die letztes Jahr das Toupet hatten, ebendiese einzufordern.

  • Grazia sagt:

    Hier einige interessante Betrachtungen darüber, wie es überhaupt zu diesem Fach kam.

    „(…) Bis zum Beginn des neuen Jahrtausends erteilten im Kanton Zürich (…) staatlich ausgebildete Lehrerinnen und Lehrer das Fach „Biblische Geschichte und Lebenskunde“ auf der Primarstufe, während auf der Oberstufe evangelische Pfarrerinnen und Pfarrer sowie katholische Religionslehrerinnen und -lehrer den zweistündigen bekenntnisorientierten konfessionell-kooperativen Religions- unterricht (..). Dieses Konzept geriet im Laufe der Zeit mehr und mehr in eine Krise. Zum einen wirkte sich die mangelnde religiöse Sozialisation in den Familien immer stärker im schulischen Religionsunterricht aus, zum anderen bereitete die Erteilung des Faches „Biblische Geschichte“ manchen Lehrpersonen nicht unerhebliche Schwierigkeiten. Probleme ergaben sich ferner dadurch, dass die von außerhalb in die Schule kommenden kirchlichen Lehrpersonen in unterschiedlicher Weise für ihre Aufgabe ausgebildet waren. Insbesondere im achten Schuljahr häuften sich Disziplinschwierigkeiten. Hinzu kam das schulorganisatorische Problem, im religiös stark durchmischten Großraum Zürich für die nichtchristlichen Schülerinnen und Schüler, die nicht am Religionsunterricht teilnahmen, die Aufsichtspflicht der Schule zu gewährleisten. (..). Hierzu setzte der Bildungsrat eine Kommission ein, der neben Vertretern der reformierten und katholischen Kirche auch Vertreter der andern Weltreligionen angehörten (…)

    Bemerkenswert ist die Unterschriftensammlung im Kanton Zürich im Jahr 2004 für die Beibehaltung des Fachs „Biblische Geschichte“. Die erfolgreiche Volksinitiative mit ca. 50.000 Stimmen motivierte die Kommission und den Bildungsrat, auch für die Primarschule einen den heutigen Verhältnissen angemessenen Religionsunterricht zu entwickeln. (..)

    Mittlerweile ersetzt „Religion und Kultur“ auch den bisherigen Religionsunterricht an der Primarschule, wobei auf dieser Stufe das Christentum prioritär behandelt wird, was mit der Geschichte der Schweiz im Zusammenhang steht. Für alle Stufen werden derzeit unter Beteiligung der Fachwissenschaften Theologie, Religionswissenschaft, Islamwissenschaft, Indologie und Judentum neue Unterrichtsmittel erarbeitet. (…)“

    Es zeigt sich, dass 1. Religion für die Schüler und wohl auch Eltern zu einem grossen Teil keinerlei Bedeutung im Alltag hatte, wogegen man 2. von Kirchen- und Staatsseite anzukämpfen musste. Dass 3. gerade ältere Schüler nicht wirklich begeistert werden konnten (s. Disziplin) und dass sich 4. Bibelliebhaber eher mobilisieren lassen als Anhänger von Tolkien oder Sartre. Offensichtlich war den Zuständigen die – doch sehr weitverbreitete – nichtreligiöse Erfahrungswelt der Zöglinge keinerlei Berücksichtigung wert. An Vertretern aus laizistischen Kreisen fehlte es oder man wollte sie nicht finden.

    Quelle: http://tinyurl.com/69c6vd3

  • Martin CH sagt:

    Wer oder Was ist Gott? Was bedeutet oder ist Religion eigentlich? Was heisst Glauben?

    Die Religion gehört zum Menschen. Denn jeder Mensch hat eine Religion auch diejenigen die behaupten sie hätten keine.
    Religion kommta aus dem lateinischen religare, und heisst soviel wie „zurückbinden“
    Jeder Mensch “bindet sich auf etwas zurück” kein Mensch kann alleine überleben.
    Die Götter die heute verehrt werden sind meistens das Geld und die Beziehung natürlich gibt es noch viele andere. Natürlich sind die wichtig, doch denke ich, die sollten nicht unsere Götter sein.
    Denn diese Götter sind endlich und haben keinen wirklichen bestand sie können zerfallen und tun dies auch immer wieder.

    Was bedeutet Glauben?
    im althochdeutschen galaubian = lieb haben
    im hebräischen Aman = fest stehen, gegründet sein
    im griechischen pistoiein = vertrauen.
    im latein credo / cordare = sein Herz geben, sein Herz an etwas hängen

    Glaube bedeutet also unser Herz an etwas hängen und Religion beschäftig sich mit der Frage worauf können wir ganz sicher vertrauen, woran können wir sicher uns Herz hängen, ohne das es verletzt wird.

    Wenn wir die Welt anschauen, wie wir sie erleben und wie sie ist. Dann müssen wir sagen es gibt IN dieser Welt nichts auf das wir uns hundertprozentig verlassen können. Alles ist endlich, vergeht und kann zerstört werden.

    Ich weiss wirklich nicht, ob es einen Gott gibt.
    Doch ich glaube an ihn und Gründe auf ihm mein Leben.

    Denn ich lese die Evangelien und sehe wie Jesus gelebt hat und ich sehe wie viele Menschen/Heilige durch die Jarhunderte gelebt haben. Ich lese, dass sie aus einer unglaublich grossen Kraft heraus gelebt haben. Sie zeigen mir, dass es ein Kraft gibt die grösser ist als wir Menschen.

    Der Gott des Christentums ist die Quelle der Liebe. diese Quelle ist nicht IN dieser Welt.
    Die Liebe ist IN der Welt aber nicht VON der Welt.
    Gott ist nicht von dieser Welt, darum können wir ihn auch nicht beweisen. Er/sie hat ihren Ursprung nicht hier. Doch Sie/Er durchdringt diese ganze Welt.

    Doch Jesus Christus kann ich an Gott “Vater” glauben, denn er hat die Quelle bezeugt/gelebt/gezeigt.
    Durch den Heiligen Geist in uns sind wir mit Gott verbunden und haben anteil an diesem Gott.

    Dieser Gott wird in der Welt konkret wo das Reich Gottes die Botschaft Jesu Christi gelebt wird. Das Reich Gottes ist Gerechtigkeit, Frieden und Freude im Heiligen Geist.
    im Heiligen Geist =in der Liebe zu sich selbst und dem Nächsten.

    Ich glaube wenn wir das Christentum verbannen aus unserer Gesellschaft. Dann werden wir das Bad mitsammt dem Kind ausschütten.

    Ich jedenfalls bin durch aus gespannt wie lange wir Menschen noch das Geld, die Arbeit, die Leistung, die Beziehungen, die Systeme, der Körper als absolut sehen respektive als Götter anbeten werden.

  • Eremit sagt:

    „…doch weltweit gebe es eben auch die komplementäre Tendenz zur Verschärfung der religiösen Bekenntnisse.“

    Tja, warum? Kann es sein, dass durch die Säkularisierung ein gewisser Egoismus sich im globalen Dorf breit gemacht hat und einige Menschen durch die Flucht in eine Religion versuchen dem entgegen zu wirken? Dem entsprechend müsste man hingehen und ab der ersten Klasse psychologie Unterrichten mit den Prinzipen des Egos und die Folgen des Egoismus anstelle des Fachs Religion und Kultur. Wer kann besser, unmissverständlich das Judentum erklären als ein Rabi? Und wer kann besser, unmissverständlich das Christentum erklären als ein Pfarrer (der selbst nicht durch eine Scheidung die Frau aus dem Haus warf)? Wer kann besser, unmissverständlich das Koranertum erklären als ein Iman? Wer kann besser, unmissverständlich den Kofuzeismus erklären als ein konfuzeanischer Mönch? Wenn der Staat hingeht und all diese Personen durch eine „fachfremde“ Person ersetzen will, so endet das wohl wie hier in einzelnen Schulen mit dem Pflichtfach Ethik in dem der Dozent mit beschränkter tendenziöser Sichtweise regelmässig über christliche Religionen lästerte (selbst miterlebt). Man muss sich dabei fragen, wenn die sogenannten Freidenker gegen die Nächstenliebe, das höchste Gebot der Christen, sind, wohin wird sich solch eine Gesellschaft entwicklen und wie „sozial“ wird solch eine Gesellschaft sein ohne Nächstenliebe.

    Schulen mit Lehrern müssen m.E. die Aufgabe haben den Schülern/innen logische, „rationalistisches“ Wissen zu vermitteln, wobei nicht jeder mit derUnterstüzung der Mehrheit der von sich aus behauptet „rationalistisch“ zu sein dies auch wirklich ist, und als faire Rahmenbedingungen sicherstellen, dass der/die einzelne Schüler/in dabei nicht durch Mitschüler/innen und z.B. Gruppendruck daran gehindert werden. Mehr nicht. Und schon gar keine gruppendynamisch manifestierte Sichtweise als Allgemeinwissen. Andernfalls steht es nicht wirklich rosig aus für die eigene Zukunft als Wissensgesellschaft.

  • fufi sagt:

    @alle hier und vor allem
    @diejenigen, die über’s Christentum im Speziellen und die Religionen im Allgemeinen herziehen.
    Wer’s noch nicht wissen sollte: ich bin Christ und Theologe.
    Ich will und kann auch nicht zu allen derzeit 441 Kommentaren meinen eigenen Senf dazugeben.
    Bin aber sehr gerne bereit, ernst gemeinte Fragen zu beantworten.
    Falls das gewünscht werden sollte:
    „Antworten“ drücken und Frage eingeben!
    😀

    • Eremit sagt:

      Echt? Warum verwenden viele Christen falsch abgeschrieben übersetzte, sei es aus Unwissenheit, sei es aus gekränktem Ego, sei es aus berechneter Intriege, Version der Bibel als Basis und übersetzen diese dann in die einzelnen Sprachen? Bei solch philosophischen Widersprüche der Schulbibel von heute(?) können logischer Weise nur viele kopfschüttelnd davon laufen.

      • fufi sagt:

        @Eremit
        Lassen wir zunächst die „Unwissenden“ aus dem Spiel. ja?
        🙁
        zum 2ten: Es ist halt nun einfach so, das sich für jedwede, auch noch so absurde Meinung sicher mindestens 1 biblischer Beleg finden lässt. Was natürlich KEIN Argument sein kann, aber es soll welche geben, die damit argumentieren zu dürfen meine. Bsp: Meine – ganz entgegen der Bibel! – dass der Hase KEIN Wiederkäuer sei!
        😛
        zu 3tten: Das, was wir jeute als „Bibel“ lesen – oder auch nicht – ist ein Sammelsurium von Texten, die plusminus im Zeitraum von 1000 Jahren aufgeschrieben wurden. Manche davon wurden vorher noch werweisswieviele Jahrhunderte bloss mündlich überliefert … .
        DA kann’s doch niemanden wundern, wenn das ganze Werk logisch-philosophisch von Widersprüchen nur so strotzt?
        Aber letztlich erheben ALLE religiösen Schriften, Erzählungen etc. glaub auch nicht den Anspruch, einer neuzeitlich-logisch-philosophischen Denkweise genüge zu tun zu wollen?
        🙁

    • marcus sagt:

      warum sind sie christ?

  • suha sagt:

    Religion gehört nicht in die Schule, Religion trennt, – hier die Katholiken, da die Protestanten – hier die Christen, da die Moslems! – wir brauchen aber ethische Werte, die auch in der Schule vermittelt werden können, und zwar unserer Kultur entsprechende ethische Werte auf christlicher Basis und zwar christlich = von Jesus Christus = neues Testament, das alte Testtament erzählt nur was VOR dem Christentum war – Wie der Mensch mit christlichen Werten (= Liebe, Verzeihung) solch überholte Verhaltensweisen überwinden kann zeigt Jesus Christus auf. Auf Ihn bezieht sich schliesslich das CHRISTEN-tum!
    Wir alle und vor allem unsere Kinder sehnen sich nach verständlichen und sinnvollen Werten, nach denen sich zu leben lohnt! – diese werden nicht von Religionen vermittelt, sondern vom richtigen Verständnis der christlichen Werte, deren Vermittlung und VOR ALLEM durch SELBER DENKEN und ERKENNEN. Wir können aber nur selber zu denken beginnen, wenn wir auch entsprechende Anregung und Ermutigung erhalten. Wir sollen schlussendlich selber entscheiden dürfen was wir glauben möchten und was nicht, was für uns stimmt und was nicht.
    In einem Fach Ethik sollte ein breiter Fächer von Themen angesprochen werden mit den Schülern, die altersgerecht und alltagstauglich praktisch sind. z. B. Gruppengespräche :Was ist Gott für mich? Nützt beten etwas? Wie betet man denn überhaupt ? Wie reagiere ich wenn jemand gemein ist zu mir? Wie kann ich erkennen ob ein Fremder Mensch lieb oder böse ist? Was hat Menschen vor 20 / 30 / 50 / 100 Jahen bewegt? Was für Glaubensmodelle und Glaubensrichtungen gibt es? usw. usw.
    Mit einem engagierten Lehrer/- in wäre das ein äusserst interessantes und wichtiges Fach!

  • Die Autorin fragt sich, wie Ethik begründet werden kann. Nun ja, es ist so, dass die Moral begründet werden kann. Und zwar mit Hilfe der Ethik. Die wissenschaftliche Ethik ist eine Teildisziplin der Philosophie. Nach Höffe sucht die philosophische Ethik „… auf methodischem Weg … u. ohne letzte Berufung auf politische und religiöse Autoritäten … oder auf das von alters her Gewohnte u. Bewährte allgemeingültige Aussagen über das gute u. gerechte Handeln“. Man muss also nicht nur nicht auf eine „christliche Wirkungsgeschichte“ zurückgreifen – man darf es auch nicht. Etwa anderes ist die Ethik, die die Theologen treiben. Die ist auf Gott und damit auf Sand gebaut.

    • Chris M. sagt:

      Aber,…..

      All diese Ethiken bauen doch ihrerseits wieder auf letztlich unbeweisbare Grundregel auf (Dogmen), die sie dann wieder von anderen Ethiken unterscheiden. Jede wird von den Anhängern der anderen Schulen in Frage gestellt.
      Wenn es dann um moralische Urteile im konkreten Fall geht, können je nach angewandter „Ethik“ die Antworten meilenweit auseinander liegen, manchmal sogar diametral. Da fehlt manchmal sogar noch der Sand….. 😉 Letztlich sind es alles künstliche Gedankengebäude und es gibt keinen Grund, sich gegenüber Theologen auf das hohe Ross zu setzen.

      Nebenbei: unsere so „objektiven“ westlichen Ethiken entlarven sich sehr schnell als religiös und kulturell geprägt, wenn man Antworten auf konkrete Fragestellung mit Antworten zB. aus chinesischer Tradition vergleicht und dann nach den Ursachen für die Differenzen fragt.

      • In der Tierethik ist z.B. das Leiden ein zentrales Argument. Das Leiden ist kein Dogma, sondern ein Zustand. Es braucht auch nicht bewiesen zu werden – es ist ganz offensichtlich da.

  • Ted Nimel sagt:

    Wieso soll die biblische Schöpfungsgeschichte unterrichtet werden?
    Wieso nicht die Erschaffung der Welt durch den Sonnengott Re? Die Plausibilität von beiden Geschichten ist gleich.
    Das soll mir mal einer Erklären..
    (und kommt mir nicht mit der Abendländischen Kultur.. dies Geschichtchen ist im nahen Osten entstanden.)

    • Eremit sagt:

      Ist der angebliche Sonnengott Re der einzige Gott, oder gibt es da dann noch andere Götter?
      Was passiert wenn die Götter uneins sind kennen wir schon von der griechischen Mythologie und bei mehrern Göttern ist der Atheismus m.E. vernünftiger.

  • Katharina sagt:

    Ein sehr interessantes Thema. Und ie immer, ausgezeichnet eingefädelt aus einem alltäglichen Erlebnis, so wie es in vielen Familien vorkommt. Das ist, was mir an Ihren Artikeln so gefällt, denn es macht die Fragestellungen für viele so gut nachvollziehbar.

    In dem Sinn empfehlenswert zu lesen und ‚I like!’.

    Ich finde jedoch, dass Begriffe vermischt werden denn:

    Einerseits muss getrennt werden zwischen Religionsunterricht als Vermittlung der wesentlichen gedanklichen Aspekte der verschiedenen Weltreligionen,
    und
    Religionsunterricht als Vermittlung der Riten und Praxis einer Glaubenstradition.

    Ist Schule eine staatliche Institution, dann MUSS der zweite Aspekt von Religionsunterricht aussen vor bleiben, als Konsequenz eines säkularisierten Staatswesens mit seiner Trennung von Institutionen, und da dann der Trennung von Kirche und Staat.

    Weiter wird nicht erwähnt, dass der Begriff Religion auch den Begriff Glaube konnotiert. Glaube ist eine persönliche Einstellung und je nach Einstellung dann eine persönliche Beziehung zu all den ultimativen Fragen, die mit dem Wort Glaube zusammengefasst sind.

    Wie alle Beziehungsfragen ist auch das Angelegenheit der Familie, nicht der Schule oder des Staates.

    Aufgabe einer Schule ist es jedoch auch, Geschichte zu lehren, im Sinn von so sind wir dahin gelangt wo wir als Gesellschaft nun sind. Ein wesentlicher Teil davon ist das Denken und wie dieses sich über die Zeit geändert hat und wie es Geschichte beeinflusste. Daraus folgt dann, dass Geschichte der Philosophie, bzw. wie religiöse Gedankengebäude darauf Einfluss nahmen, Teil des Unterrichtes sein muss.

    Weshalb ich jedoch finde, dass die Freidenker doch etwas recht haben, ist, weil ich vermute, dass die Trennung zwischen dem geschichtlichen Aspekt, dem aufzeichnen des Weges im Unterricht nicht getrennt wird von der Vermittlung von Riten und der Bewertung dieser, sprich über die Hintertür werden die Landeskirchen dann wieder begünstigt.

    • Katharina sagt:

      Ich möchte hier noch anfügen, dass ich an der Diskussion selber kritisiere, dass Ihr über die Existenz eines Gottes diskutiert und da wie es eben üblich ist, die Agnostiker und Atheisten überzeugen wollt dass es sie gebe, und umgekehrt die anderen eben, dass es ihn nicht gebe. Das ist, was den Unterricht des Themas an der Schule betrifft, nicht die Frage, denn es ist nicht Aufgabe des Staates, jemanden zu einem Glauben zu ‚bewegen’, so wie der Staat ja auch nicht Personen zu einer bestimmten Art von Beziehungen ‚bewegen’ kann.

      • Auch sehr einverstanden. Es geht einfach darum, wie intelligent es ist, sich von „Freidenker“-Seite gegen den Religionsunterricht zu wehren.

        Die eigentliche Frage stellte einmal Umberto Eco einem Kardinal und hier liegt eben das Konfliktpotenzial für unsere Gesellschaft:

        „Moderator Marco Meier beendet die Debatte mit einer Frage von Umberto Eco an den Kardinal von Mailand: «Gibt es einen Begriff von Hoffnung, der Gläubigen und Nichtgläubigen gemein sein könnte?»

        Nein.“

        Das „Nein“ setzte der Journalist Constantin Seibt darunter. Und es ist wohl eine (leider) zutreffende Analyse.

      • Nemo sagt:

        fully agree! Aber Katharina im erwähnten Hombrechtiger Fall, war es eben genau so, dass der Lehrer respektive das Lehrmittel die SchulerInnen zum Glauben zu bewegen wollten. Und dies ist zu kritisieren

    • Blitz Blank sagt:

      Sehr einverstanden. Danke!

    • Orlando S. sagt:

      Weiter oben postete so eine Lehrerin dieses Fachs, eine „Agnostikerin und Freidenkermitlied“. Ich glaube nicht, dass diese Frau NICHT Partei ist, wenn sie das Fach unterrichtet, ebensowenig wie es ein Mönch oder ein Vineyard-Bibelgruppe-Mitglied wäre.

      Die Diskussion um Gottbeweis und so ist doch spannend! Typisch Mamablog, die „community“ bricht das Thema immer auf den Aspekt runter: was beschäftigt mich als Blogger in Bezug auf dieses Thema. Selten ist es Familie, Mutterschaft oder Schulsystem. Es sind grundlegendere Fragen. Ist doch gut so…?

      Ansonsten: Absolut einverstanden!

      • Lukas Gloor sagt:

        Ist der Agnostizismus nicht der Inbegriff von parteilos? Ausserdem, wenn mir einmal davon ausgehen, dass es keine Indizien dafür gibt, dass irgend eine der Religionen wahr ist, ist es dann nicht vollkommen objektiv, religionslos zu sein? Und weiter, wäre es dann voreingenommen, sich als Freidenkerin für die Trennung von Religion und Staat einzusetzen, wenn dieses Prinzip (das u.a. in den Menschenrechten verankert ist) im Land nicht durchgesetzt wird?

        Wenn Sie also dieser Person nur aufgrund ihrer Freidenkermitgliedschaft vorwerfen wollen, nicht objektiv zu sein, dann liegt es doch an Ihnen, Indizien zu liefern die suggerieren, dass an den Religionen etwas wahres dran ist. Denn ohne Indizien gibt es keine guten Gründe, irgend etwas zu glauben. Es ist nicht die Aufgabe der Skeptiker, die nicht-Existenz von etwas zu beweisen — dies ist per definitionem unmöglich, sei es bei Gott oder bei pinken Einhörnern, oder Narnia in meinem Schrank.

      • Katharina sagt:

        Mister O, ich finde die Diskussion um einen Gottesbeweis auch interessant. es ist sicher vorhersehbar gewesen, dass der Diskurs darum gehen wird. Ich finde aber, dass es im Artikel darum geht, wie die Schulische Frage fair und unserem Kulturerbe gebührend beantwortet werden kann, ohne auf diese unsinnigen Diskussionen und Verbote von Ikonen und Symbolen persönlicher Bekenntnisse eingehen zu müssen.

        Für mich persönlich ist die Frage eines Gottesbeweises sehr wichtig, denn wenn ich davon ausgehen muss, dass da einer zumindest vom Bösen massiv beeinflusst war, dies in meiner Wahrnehmung unumstösslich so ist, dann muss es eben die andere Seite auch geben. das war für mich selber der Beweis. Eben – etwas sehr Persönliches.

        In dem Sinn möchte ich auch sagen, dass heute die Diskussion zum grössten Teil sehr gepflegt ablief.

        In meinem Umfeld leben unglaublich verwöhnte Menschen in einer Art geschützter Blase. Ein für viele bei euch vielleicht traumhaftes Ideal. keine Geldsorgen, schöner Wohnort, Haus, the whole nine yards. Ein Traum, den einige wohl als Paradies auf Erden sehen. Und diese Menschen gehen an der unsäglichen Monotonie ihres Lebens zwischen late morning brunch und early afternnon shopping in der Stadt ein.
        Das geschehen von mehr ‚Normalsterblichen‘ ist dermassen von ihrem Dasein entfernt, dass sie unfähig sind, sich überhaupt darüber Gedanken zu machen. Etwas, wo jemand mal sagte: Ich will schreien habe aber keinen Mund dazu.

        Lukas, es gibt so etwas wie vollkommene Objektivität nicht. Weshalb:

        alles was Sie lesen, hören und denken ist ein komplexes System von Wahrnehmungen und assoziativen Mustern zu gespeicherten anderen Mustern (Erinnerungen).

        Wahrheit oder Objektivität ist daher immer ein verhandelter Konsens. das Geheimnis des Erfolgs eines demokratischen Gesellschaft ist, dass die Verhandlung und die Konsensfindung ein permanenter strukturierter Prozess ist.

      • mila sagt:

        @orlando s.: wenn sie ernsthaft über die existenz gottes respektive den gottesbeweis diskutieren wollen, sollten sie schon wissen, was die grossen philosophen und theologen der letzten 2000 jahre zu diesem thema zu sagen hatten. ansonsten drehen sie sich immer im kreis, und leider auch nicht immer auf dem höchsten niveau. das ist es, was ich persönlich der debatte ankreide, und nicht, dass sie stattfindet.

      • mila sagt:

        PS: der gottesbeweis in der geschichte – wäre das nicht ein tolles thema für den religionsunterricht? für alle wäre etwas dabei, die christen, die nicht-christen, die agnostiker und sogar für die atheisten.

      • Orlando S. sagt:

        @mila: sie amüsieren mich! Sie sähen es wohl gerne, wenn ich hier argumentiere wie ein Jurist mit Bundesgerichtsentscheiden und einschlägiger Literatur und zu jedem Erkenntnisschritt die relevanten Autoren und Philosophen referenziere, die mir bei dieser meiner höchsteigenen Erkenntnis zu Behufe waren, nicht? Nun erstens bin ich kein Theologe, zweitens spielt sich der Weg zu meinem persönlichen Glauben tatsächlich nicht als systematischer Prozess (sondern mit sehr vielen intimen „Erkenntnissen“ und Inspirationen, die ich hier NIE nacherzählen würde) ab und drittens bin ich nicht hier um zu missionieren oder jemanden zu überzeugen (wovon? wozu?).

        Ausserdem sind ihre Vorhaltungen recht feige: von Ihnen wissen wir gar nichts, sie exponieren sich garantiert nicht und sagen Mal etwas, das vielleicht danebengeht, sie geben nie ein Statement ab sondern schlingen sich wie ein Efeu an denen an, die solches tun und motzen die dann an. Wofür steht eigentlich „mila“ – in Kleinschrift? Wenn alle so wären wie Sie, sorry, dann wäre hier belangloses Geplauder, an dessen Ende wir uns mit Smileys überhäufen zur der Aussage „wir können eh nichts wissen…hihihi“. Gehobene Langeweile.

      • mila sagt:

        @orlando s.: na, so amüsant scheinen sie mich ja doch nicht zu finden… poison ivy wäre sicherlich ein netter übername für ein schattengewächs wie mich, nur wäre das keine abkürzung meines richtigen namens. nun denn.

        sehen sie, wenn mir etwas so sehr am herzen liegen würde wie ihnen offenbar die gottesfrage, dann würde ich mich ernsthaft damit auseinandersetzen und womöglich erst mal schauen, was klügere menschen zu diesem thema schon zu sagen hatten – man möchte ja nicht längst abgehakte zöpfe neu flechten, pardon: ansetzen. aber sie exponieren sich lieber mit ihrem halb-, banal- oder nichtwissen, das ist ihr gutes recht. nur müssen sie damit rechnen, dass solche pendanten wie ich sie auf ihre unzulänglichkeiten nur zu gerne hinweisen werden.

        PS: im übrigen finde ich meine persönliche meinung in der regel für nicht so interessant, als dass ich sie jedem hier unter die nase reiben müsste…

      • Orlando S. sagt:

        ahem…so etwas wie der Weg zum eigenen Glauben MUSS man glaubs schon als „alter Zopf neu flechten“. Sogar jeden Tag.

        Hm, ich sehe gerade, dass das sehr persönlich wird. Und dass sie mich jetzt wirklich verletzt haben, seltsam, das gelingt hier den wenigsten.

        Ich frage mich nur, welchen Frust man loswerden muss, indem man pauschal anderen mangelnde „Ernsthaftgkeit“ bei so einem Thema attestiert (ohne selber auch nur ein Fünkchen zur Diskussion beizutragen) und lehrerinnenhaft auf „Unzulänglichkeiten“ hinweisen will…

        Dann weisen sie mir bitte eine objektiv unwahre Aussage nach! Ich bin sehr gespannt.

        Ihre Meinung sei nicht interessant? Was tun sie dann ausgerechnet hier, wo man „kommentiert“?
        Bl0g-Gouvernante mit etwas geisteswissenschaftlichem Hintergrund? Jenen Knüppel zwischen die Beine werfen, die irritierende Ideen liefern, damit alle brav schweigen wie im Vorlesungssaal?
        Die streng darüber wacht, dass nur einschlägig Berufene im erlauchten Expertenkreis über solche Themen plaudern dürfen.

      • mila sagt:

        in diesem blog kann man auch ‚zuhören‘, und wenn sie mir besser ‚zugehört‘ hätten, hätten sie einiges über mich erfahren können. aus meiner sicht habe ich durchaus inhaltliches zur diskussion beigetragen, indem ich für die sichtweise eingetreten bin, dass mit den mitteln der wissenschaft nicht über glaubensfragen nicht entschieden werden kann und umgekehrt – aber diese sicht müssen sie ja nicht teilen. wobei ich grundsätzlich den eindruck habe, dass sie jeweils nur ihre eigene meinung und die, die der ihren ähnlich sind, gelten lassen.

        persönlich ist es übrigens geworden, als sie mir vorgeworfen haben, feige zu sein, belanglos und eine schmarotzerische klette. if you can’t stand the heat, get out of the kitchen. ich gehöre sicherlich nicht zu denen, die die rechte wange hinhalten werden, my friend. persönlich verletzen will ich allerdings niemanden; sollte es dazu gekommen sein, entschuldige ich mich hiermit bei ihnen.

      • Orlando S. sagt:

        Liebe mila

        seit zwei Wochen verfolgen mich ihre Kommentare mit jeweils dem ätzenden Unterton, ich sei ein Grossmaul, ungebildet und mich masslos überschätzend. Nie eine sachliche Widerlegung, kein Gegenargument, kein „da irren sie sich aber, weil…“. Sie treten wie eine Schiedsrichterin auf und rügen, ohne selber was zu liefern. Bitte vielmals um Entschuldigung, dass ich etwas anderes als Theologie und Philosophie studiert habe. Disqualifiziert mich das in ihren Augen? Scho e chli, gell!…Seien sie doch einfach ehrlich zu sich selber: was regt sie an mir so auf?

        „If you can’t stand the heat“ – machen sie sich keine Sorgen, ich trage einen feuerfesten Anzug. Deshalb betrifft mich ihr Vorwurf des Halb- und Nichtwissens kaum, obwohl sie es wohl als saftige Beleidigung formuliert haben. Was mich nervt ist, dass sie offenbar ihr in langen Jahren am Kolleg erworbenes Vollwissen in ihrem (vermutlich) hübschen Köpfchen unter Verschluss halten, dafür angebliche „Unzulänglichkeiten“ tadeln wollen. Ich halte es so, wenn mich ein Thema nicht interessiert oder ich mir dazu keine Meinung gebildet habe, dann halte ich mich auch raus.

        Es ist schon so, ich schreibe, was ich schreibe, um Reaktionen zu provozieren. Ich will die Leute in ihren bequemen, muffigen meist linksliberalen Weltbildern und „Einstellungen“ herausfordern, die sich über einen offenen Diskurs gelegt haben wie eine Verkrustung.

        Ich sehe, sie fühlen sich schnell angegriffen. Nun, ich wollte sie gleichfalls nicht persönlich beleidigen, my friend. Sorry.

      • mila sagt:

        wie gut, dass sie keine mimose sind, ich bin nämlich auch keine. sie wollen wissen, was mich an ihnen nervt – voilà: provokation um der reinen provokation willen ist mein ding nicht, da provoziere ich eben gerne zurück. the symbol, der ich ebenfalls reine polemik unterstellt habe, hat es geschafft, mich vom gegenteil zu überzeugen, und wenn es ihnen ebenfalls gelingen würde, mich mit etwas anderem als ihrer selbstgefälligkeit zu irritieren, dann würde ich auch vor ihnen den hut ziehen, versprochen. und nein, ich befürworte keine verkrusteten diskurse, habe rein gar nichts gegen gesunde kontroversen, nur sollten diese schon etwas substanz anstelle des üblichen wischiwaschi-allerleis beinhalten. ich kann es auch anders formulieren: originelles denken ist vor allem eins: fundiertes denken, denn nur wer die jeweiligen grundlagen kennt, kann in einer sache gegebenenfalls einen neuen beitrag leisten. um jedoch den eindruck des cyberstalkings zu vermeiden, sehe ich in zukunft lieber davon ab, meinen degen mit ihrem zu wetzen, zumal wir beide wohl nie auf einen grünen zweig kommen werden.

        PS:
        sachliche gegenbeweise erübrigen sich bei ihnen in den meisten fällen, da ihre argumentation vieles ist – manchmal sogar ansatzweise lustig – nur eben eins nicht: sachlich. die meisten themen, die hier verhandelt werden, fallen zudem in den bereich der weltanschauung, und wer will schon hinsichtlich persönlicher einstellungen beurteilen wollen, was ‚richtig‘ ist und was ‚falsch‘?

      • Orlando S. sagt:

        Aber, aber, liebe mila: Zurückprovozieren sieht doch nicht so aus: „Sie drehen im Kreis und leider nicht auf dem höchsten Niveau“, „…mit ihrem Halb-. und Nichtwissen“ und „nur wer die jeweiligen grundlagen kennt, kann in einer sache gegebenenfalls einen neuen beitrag leisten“. Haben sie nichts etwas Originelleres drauf? Deshalb verglich ich sie mit einer Gouvernante, null Sexappeal bislang. Dabei sind sie nicht gerade dumm.

        Sie sind ein kluges Weiblein, dass sich zurücklehnt und sich gerne von mir überzeugen lassen will. Clever! Ein dummer Mann würde darauf hereinfallen und auf Knien um ihre Anerkennung betteln. Hier gibt es aber keine solche Dynamik, nicht einmal auf einer Sub-Ebene. Zu virtuell – ich muss sie also enttäuschen.
        🙁

        Na, wenigstens finden sie meine Sachen zum Teil ansatzweise lustig. Sie müssten mal dabeisein, wenn ich das Zeugs verfasse: ich amüsiere mich prächtig. Auch in mir verbirgt sich ein kleiner Hedonist, ein triebhafter Satyr gar. Vielleicht ist das ja der Schlüssel, wie sie meine Texte in Zukunft lesen sollten…?

      • mila sagt:

        dass sie ihren spass haben, ist klar zu erkennen – wenn sie mich ebenfalls auf einer einigermassen regelmässigen basis unterhalten würden, müssten sie mich noch nicht einmal überzeugen (leider überwiegt das nervige das lustige in den meisten ihrer beiträge bei weitem). und falls sie es noch nicht wissen sollten: das gouvernantenhafte übt auf gewisse männer durchaus einen eigenen charme aus (nicht, dass ich damit gesagt hätte, dass ich im richtigen leben auch so gouvernantenhaft bin…).

      • Orlando S. sagt:

        *gähn*…mhmm, sicher jaja. Wie? Nerven, hmja gerne, aber erst in ein par Tagen wieder. Bis dahin: passen sie auf, dass sie nicht vor Langeweile ins Koma fallen. *augenverdreh*

  • Blitz Blank sagt:

    1. Wer sieht schon in der Schweizer Flagge einen hängenden Christus? = keiner = irrelevant.
    2. Ändert ein anderes Symbol etwas an der Arbeit des Rote Kreuzes? = Nein = irrelevant.
    3. Wer kennt schon den Text des Schweizerpsalms? = nahezu keiner = irrelevant.
    4. Ja 100%
    5. Beibehalten und in eidg. Besinnungstag umtaufen.
    6. Nein. Die Kirchen, die im staatlichen Dienst stehen, müssen als Entgelt für ihre Privilegien (Steuererhebung) Leistungen für die Gesellschaft erbringen.

    • Blitz Blank sagt:

      Sorry, dieser Kommentar hat sich am falschen Ort niedergelassen.

    • Rocket sagt:

      Ich schliesse mich an. Das Kreuz ist keineswegs ein rein christliches Symbol. Kelten und unzählige andere Kulturen benutz(t)en es. Das schöne Schweizerkreuz ist heute ein Symbol für eine ziemlich gut funktionierende Staats- und Gesellschaftsform, die sich zum Glück von sprechenden Schlangen, Männern in Fischen und dergleichen emanzipiziert hat.

  • PlainCitizen sagt:

    „Gründen letztlich nicht auch humanistisch-ethische Werte auf einem aufgeklärten Glauben?“

    Es ist umgekehrt. Die Gottesverkäufer nutzen die natürlichen Neigungen des Menschen und behaupten, die seien von Gott erfunden, und damit sei Gott bewiesen. Ein Zirkelschluss, aber ein praktischer für die Gottesverkäufer.

  • PlainCitizen sagt:

    Wir glauben an Gott, weil wir die Sprache haben. Seit wir Sprache haben, kann Hans dem Max etwas über Gritli erzählen, das er erfindet. Also passt sie besser auf, was sie tut, damit das Erzählte klar widerlegt ist. Und so entsteht die Selbstdisziplin. Das Prinzip Aufpassen haben wir aber so gut verinnerlicht, dass wir glauben, es gebe einen, der alles sehe. Und der heisst Gott, und es gibt ihn, wie jederr bestätigen wird, der sein Geld mit ihm verdient.

  • tobe or not tobe sagt:

    AN DER LÄNGE DIESER TEXTE HIER MUSS ICH FESTSTELLEN:

    IHR KÖNNT OCH 1000 JAHR ÜBER DEN SINN VON RELIGION UND WELCHER GLAUBE JETZT BESSER IST DISKUTIEREN, IHR KOMMT NIE ZU EINEM ENDE..

    Ein Ende ist in Sicht wen Gläubige, für sich behalten was sie glauben und atheisten ihre Meinung für sich behalten. Wie schon gesagt, für jeden Menschen auf der Welt gibt es eine eigene Religion (zumindest in jedem einzelnen Kopf)

  • Rahel sagt:

    Liebe Kim

    Beim Lesen Deines Posts ist es mir eiskalt den Rücken runtergelaufen! Es tut mir so leid für Dich! Ich könnte heulen! Auch Du bist mir, nebst einigen anderen hier, mittlerweilen sehr lieb geworden und auch ich werde Deine Kommentare vermissen!
    Dass Du Dich, nach diesen schlimmen Neuigkeiten und der bevorstehenden Geburt, von hier erstmals zurückziehst, kann ich sehr gut verstehen! Ich wünsche Dir ganz viel Kraft und bete für Dich, dass doch alles ein gutes Ende nimmt! Und ich freue mich jederzeit riesig, von Dir zu lesen, aber fühl Dich in keinster Weise gedrängt! Deine Gesundheit steht eindeutig vor der Bloggerei! Ich werde sehr gerne mit Dir Kontakt aufnehmen!

    Ich denke an Dich und drücke Dich! Liebe Grüsse: Rahel

    • Rahel sagt:

      Sorry an alle: meine Antwort gehört weiter rauf! Bin grad etwas neben der Spur, nach dem Gelesenen!

      • Es geht mir auch so.

        Auch dem Blog selbst geht es heute nicht so gut. Er verschluckt scheinbar nach Belieben Posts und würgt sie wieder hervor. fufis Bedauernspost an Kim hat er auch geschluckt, nachdem er schon sichtbar war, meiner war zwischendurch lange nicht vorhanden.

      • Rahel sagt:

        Ja, ist mir auch aufgefallen! Tja………… wos willst do mochn? 🙂

    • Kim sagt:

      Danke, das ist lieb von dir, ich werd das schaffen, ich muss auch und ich freue mich, zwischendurch meine Nase in den Blog zu stecken und von euch zu lesen.

  • Tamar von Siebental sagt:

    Warum kann man Gott nicht einfach in sich selber sehen, anstatt von ihm zu verlangen dass er unsere Sauordnung aufräumt? Warum unternehmen wir nicht selber etwas gegen Krieg anstatt Gott dafür zu verfluchen, dass er den Krieg nicht beendet? Warum macht man nicht selber täglich etwas für den Schutz der Umwelt anstatt zu fordern dass Gott mit einem Handstreich die Thunfische um das Millionenfache vermehrt?

    Hat uns Gott uns nicht den Verstand gegeben Sorge zu unserer Umwelt zu tragen? Alles schlecht wird immer auf Gott abgeschoben, aber wenn etwas Gutes geschieht, dann hatte Gott selbstverständlich nichts damit zu tun. Wenn man die Prüfung versiebt hat, dann ist Gott ein A……, aber wenn man sie bestanden hat, dann nur darum, weil man so fleissig war. Stirbt ein Kind an der Folge von Unfall oder Krankheit, dann ist Gott ein Mörder und wenn das Kind überlebt, dann ist das den nur den Ärzten zu verdanken.

    Vielleicht sollte man das einfach so sehen: Gott schickt die Menschen um gutes zu tun, er gibt ihnen den Verstand Ärzte oder Politiker zu werden. Wenn der Politiker aus Geldgier versagt dann liegt es nicht in der Macht Gottes das zu ändern und wenn die Ärzte nicht mehr helfen können, dann kann Gott nicht immer helfen aber manchmal.

    Wunder geschehen jeden Tag, ich habe es erlebt beim Unfall meines Sohnes. Schön zu wissen, dass es Menschen gibt, die sich darum bemüht haben, sein Leben zu retten und es auch geschafft haben.

    • Rocket sagt:

      Es ist sehr schwierig etwas zu sehen, das höchstwahrscheinlich nicht existiert (abgesehen von einer starken inneren Empfindung).
      Unten widersprechen Sie sich. Sehr viele religiöse Menschen, sehen doch in dem Guten Gotteswerk, und im Schlechten vermuten sie den Mensch. Was wenn der Mensch beides tut? Gutes und Schlechtes?

      Warum sollte ein allmächtiger Gott versagende Politiker nicht „verbessern“ könne? Warum braucht es in einem Universum mit einem allmächtigen Gott überhaupt Ärzte?

      Die Ansichten die Sie oben kritisieren verbreiten Sie unten, einfach mit umgekehrten Vorzeichen.

      • Rocket sagt:

        Und dann gibt es noch die Dinge die einfach passieren, wir aber gerne jemandem zuschreiben. Dann kommen virtuelle Verantwortliche wie Gott und Teufel sehr gelegen. Wenn uns unverdient Gutes widerfährt war (für die religiösen) Gott im Spiel. Wenn uns unverdient schlechtes widerfährt war es der Teufel, mangelnde Inbrunst bei der Verehrung, Gottes Wille, Dämonen o.ä.

      • Tamar von Siebental sagt:

        Was ist so schlecht am Gottglauben, wenn es hilft gutes zu tun.?

      • StefanB sagt:

        Rocket, wenn Sie Hand- oder Heimwerker sind, dann bohren Sie vielleicht hin und wieder mal ein Loch in eine Wand. Dazu nehmen Sie einen Bohrer, nehme ich an. Also bohren ja nicht Sie, sondern der Bohrer bohrt…

        Man könnte also sagen, Sie bedienen sich des Bohrers, um ein Loch in die Wand zu machen.

        Gläubige sagen nun, dass es mit den Guten Werken ebenso ist: da bedient sich Gott dieser Menschen, um Gutes zu tun. Klar tut der Mensch diese Werke, denn er hat den freien Willen erhalten, selbst zu entscheiden, ob er nun so tut, wie Gott es gerne hätte, oder ob er es bleiben lässt, oder auch das Gegenteil dessen macht.

      • Rocket sagt:

        Nichts, wenn es tatsächlich so wäre. Sind Sie der Ansicht ohne Gottesglauben könne man nichts Gutes tun? Ist Ihnen bewusst, dass z.B. George Bush aus einem göttlichen Auftrag im Irak einmarschierte? Dass die spanischen Koquistadoren auf einer göttlichen Mission waren?

        Religiosität ist nicht per se gut oder schlecht. Aber die unkritische Religiosität hat viel Leid über den Mensch gebracht. Deshalb

        1) Religionen im kulturellen und geistigen Kontext relativieren

        2) Darüber nachdenken, ob wir auf elementare Regeln (Ethik) nicht auch ohne Gott kommen würden

        3) Darüber nachdenken, ob für eine Welt, wie wir drin leben tatsächlich übernatürliche gute/schlechte Wesen nötig sind.

        1) Dient dazu, falsche Heilsversprechen zu entlarven, da Religionen offensichtlich nicht nur Gutes tun. 2) und 3) hilft uns bei 1) und sollte uns in eine ehrlichere und realistischere Beziehung zu einander, 2), und zu unserer Welt, 3), setzen. Klar kann man über 3) diskutieren, und als agnostischer Atheist kann ich (und wahrscheinlich auch alle anderen) unmöglich wissen, ob es einen Gott gibt oder nicht. Aber wenigstens muss ich nicht mehr blind einem von unzähligen Schöpfungsmythen vertrauen, sondern kann guten Gewissens meinen Verstand und wissenschaftliche (=prüfbare) Evidenz nutzen.

      • Rocket sagt:

        StefanB, der Bohrer ist mein Mittel ein Loch zu bohren, dennoch bohre ich das Loch. Ohne meinen Willen würde kein Loch entstehen. Anders bei guten Taten. Wäre Ihre Analogie richtig, könnte ohne den Willen Gottes keine gute Tat geschehen, dennoch habe ich Atheisten gesehen, die gutes taten (z.B. einer alten Frau über die Strasse halfen). Angenommen ein von Ihnen postulierter Gott existiert: Entweder arbeitet Gott auch mit Atheisten, das hätte zur Konsequenz, dass es für das Gute auf der Welt keine Rolle spielt, ob wir uns bekennen oder nicht, und ob man in den Himmel kommt ist abhängig von Formalitäten und Äusserlichkeiten, wie genügend häufigem Beten, bekennnen etc. Oder wenn ein Atheist einer alten Frau über die Strasse hilft ist es nichts Gutes, weil er Atheist ist.

        Beides scheint mir nicht stichhaltig und Ihnen wohl auch nicht?

      • the man sagt:

        Rocket, es gibt genügend moderne Theologen die sich nicht einfach mit dem Dualismus Gott-Teufel abfinden. Ich persönlich sehe das so: Ein göttliches Wesen hat den Menschen mit allen Fähigkeiten ausgerüstet, die es für den absoluten Frieden braucht. Da dieses Wesen aber nicht einfach Parteisoldaten wollte gab es ihnen auch die Möglichkeit des freien Willen. Damit sind die Menschen sowohl für das Gute, als auch für das Schlechte veranwortlich. Dass das göttliche Wesen nicht mehr eingreift ist klar, sonst bräuchten wir ja keinen freien Willen. Das ist nur meine bescheidene Ansicht – aber was solls? Was schadet es Ihnen oder der Welt, wenn ich so denke? Warum wollen Sie Menschen davon überzeugen dass ein Gott „höchstwahrscheinlich nicht existiert“? Pure Rechthaberei?!?
        Und bitte kommen Sie mit jetzt nicht mit den Kreuzzügen: Sie wissen genau dass weder Busch noch Cortez wirklich um den Glauben ging. Gewaltorgien und Allmachtphantasien sind zutiefst Menschlich, die findet man genauso in säkularen Systemen (Nationalisten, Sozialisten,…)

      • Orlando S. sagt:

        Hallo? Theologie für Dumies: Er hat seinen Sohn geschickt um zu zeigen, was es heisst Gutes zu tun, nach dem Schönen, Guten und Wahren zu streben! Mit den Juden hat er sowieso eine exklusive Beziehung, aber uns hat er den Heiland geschickt, der uns erlösen sollte indem er am Kreuz für uns und durch uns starb (nach älterer Terminologie: von unseren Sünden erlöst hat)! Und wir sind nicht so schlecht gefahren, indem wir den Erlöser angenommen haben. 2000 Jahre sind es nun!

        Nie, nie gab es ein stärkeres Bild, ein krasseres Symbol und eine verstörendere Story! Und niemals war das Angebot radikaler, so radikal, dass wir verweichlichten agnostischen Neuzeit-Menschen dagegen aussehen, wie unverbesserliche Bettnässer.

        Gott ist nicht das operative Management, der Verwaltungsratspräsident oder die Strategieanalysten: er ist die Firma.

        Was war schlecht an den Kreuzzügen?

        Und was hat Irak mit den Kreuzzügen und Cortez zu tun, Ignoramus?

      • mila sagt:

        @orlando s.: bringen sie bitte die wertesysteme nicht durcheinander, das schöne, das gute und das wahre sind themen der griechischen philosophie – plato lässt grüssen! 🙂

      • Globetrotterin sagt:

        @mila:
        So ist das bei Orlando doch schon seit Urzeiten: Er hat so ein bisschen Pseudo-Wissen, dem er dann noch ein paar intellektuell klingende Fremdwörter hinzufügt, und das Ganze verkauft er dann als „Weisheit“.

      • fufi sagt:

        1. @Rocket am 20.1.,16:34
        „Es ist sehr schwierig etwas zu sehen, das höchstwahrscheinlich nicht existiert “
        Doch nöd so ganz schaurig sicher?
        😀

        2. @Rocket am 20.1.,16:38
        Sorry, DAS isch Vor-Chîndergarte-Religion
        🙁

        3. @Rocket am 20.1.,17:07
        2) „Darüber nachdenken, ob wir auf elementare Regeln (Ethik) nicht auch ohne Gott kommen würden“
        ALLE Ethischen Regeln wurden füher an Gottheiten zurückgebunden. Die „Philosophie“ hat sie dann von den Göttern entfernt und mit irgendwelchen andere hehren Werten verknüpft, wie etwa „Wohlstand“, Fortschritt“, Volk“, Nation“,“Heimatland“ – weiss einfach nicht, ob DIESE EThik wirklich besser sei für die Menschen?

      • fufi sagt:

        @ Orlando S. am 20.1.11;21:16
        Wollte am heutigen Weltknuddeltag eigentlich nicht böse sein, doch
        das ist weniger Theolgie für, sonder VON Dummies!
        Fall Sie Schuster wären wüssten Sie, was ich ihnen raten würde

      • fufi sagt:

        @ Orlando S. am 20.1.11;21:16

        Kann nämlich bein^m allerbesten Willen NICHT nachvollziehen, was Kreuzzüge mit Theologie zu tun haben sollten!

      • Orlando S. sagt:

        Ach Fufilein: Kreuzzüge waren keine Militäraktionen, sondern Pilgerreisen mit dem Ziel Jerusalem, das damals von anderen Herren beherrscht wurde. Eine frühe Form des Tourismus! Im seit je hart umkämpften Heiligen Land gab es ohne Waffen kein durchkommen. Also trug man welche. Wes Geistes Kind man war, malte man sich dann (eigentlich fahrlässig) in Form eines Kreuzes noch auf die Kleider und den Schild.

        Es war nicht so, dass man unbewaffnete Geissenhirten vorgefunden hätte. Unter keinem Aspekt können „die Kreuzzüge“ (in Wahrheit sind das verschiedene, über einen Zeitraum von 200 Jahren verstreute Aktionen) mit Interessenpolitik in Verbindung gebracht werden, wie sie mit Kolonialismus oder Religionskriegen ihre Ausprägung erhielten. Als Beispiele für echte Religionskriege seien genannt: die Bartholomäusnacht, 30Jähriger Krieg, die Belagerung Wiens durch die Türken, der Sonderbundskrieg in der Schweiz, Nordirland oder 9/11.

        Nicht nur erlitten die schon damals expansiv gelaunten arabisch-mohammedanischen Völker des Nahen Ostens an ihrer Peripherie viel schmerzhaftere Verluste als durch die bunte kreuzbemalte Truppe aus Mitteleuropa, nein, auch gefiel den Touristen einiges, was sie vorfanden und nahmen es mit nach Hause. Eine gewisse „mutual infatuation“ war die Folge, die noch heut anhält.

        Das erste – plumpe – Argument, das gegen die Kreuzzüge spricht, ist: sie waren erfolgreich! Man hat die heiligen Orte gesehen und sie haben besonders die künstlerische Fantasie für Hunderte Jahre beflügelt und angeregt! Aber die paar Felsbrocken und staubigen Hügel waren es nicht Wert, sich da längerfristig zu engagieren. Und erfolgreich war auch die Verärgerung der Mohammedaner, die heute Muslime heissen. Denn die sind auch heute noch verärgert!

        Das zweite Argument gegen die Kreuzzüge ist: „niemand darf sich je in die inneren Angelegenheiten einer anderen Kultur/Religion/Familie/Staat einmischen. Punkt, basta, Ende Schluss.“ Dann hätte es nie einen Schindler gegeben, keinen D-day und kein Ende des Mordens in Sarajewo.

        Drittens die These, dass wir ein so verkommenes Menschengeschlecht sind, dass alles Andere ja nachahmens- und anbetungswürdig sein muss: „self-deprecation“ pur! Das äussert sich zum Beispiel aktuell darin, dass wir der Milliarde Chinesen mit dem warnenden Blick davon abhalten wollen, 1 Milliarde Kühlschränke und Volkswagen, Renaults und Chryslers zu kaufen. Unsere eigene Dekadenz spreche ja Bände…schon nur der Kreuzzüge wegen…

        Moment mal…

        Und wir üben uns heute regelrecht in der Pose der Flagellanten, wenn das Wort „Kreuzzug“ fällt.
        Wieso eigentlich?
        Es ist doch gar nichts passiert! Die hatten ein bisschen Angst, die anderen ebenso – so what?

      • fufi sagt:

        Ach Orlando!

    • Rahel sagt:

      Sie haben Recht! Und genau das probieren ich und meine Familie täglich zu praktizieren! Im Hinblick auf meine Kinder bedeutet das: wir lernen intensiv für eine Prüfung und wenn der Stoff „sitzt“ bitten wir Gott um Ruhe und Weisheit damit das Gelernte zum richtigen Zeitpunkt am richtigen Ort wieder in den Sinn kommt! Würden wir aber nur beten, ohne das, was in unserer Macht steht dazuzutun, würde die Prüfung garantiert in die Hosen gehen, denn pure Faulheit wird von Gott nicht unterstützt!

      • Rahel sagt:

        Entschuldigung für meine momentane Unkonzentriertheit! Meine Antwort wäre @ Tamar von Siebental!

      • Tamar von Siebental sagt:

        @ Rahel

        Sie bringen es auf den Punkt. Gott hilft denen, die sich selber helfen.

        @ Rocket

        Es spielt vielleicht wirklich keine Rolle, ob Sie sich bekennen, solange Sie gutes tun, aber vielleicht kommt das Gute in Ihnen ja doch von Gott, nur wissen Sie es nicht.

        @ the man

        Auch Sie bringen es auf den Punkt. Kreuzzüge und Judenverfolgungen habe nichts mit Gott zu tun, sondern mit Machtmissbrauch der im Namen Gottes geführt wurde. Und die Bibel ist auch von Menschen geschrieben worden, vielleicht sollte man das berücksichtigen, bevor man sich Sklaven anderer Glaubensrichtungen bedient oder sie nach vergeblicher Bekehrungsversuche um einen Kopf kürzer macht.

        Der Glauben an Gott hat nicht zwingend etwas damit zu tun, dass man sich hinter religiösen Fanatismus versteckt um schlechtes zu rechtfertigen.

        Auch der Koran wurde von Menschen geschrieben, Allah heisst Gott also kann es auch nicht in Allahs Interresse sein, Menschen anderer Glaubensrichtungen dahinzumeucheln.

      • Rahel sagt:

        Genau!!! Er ist eben nicht ein Automat, bei dem man einen Knopf drückt und man erhält das Gewünschte! Aber er ist ein „Ich-helfe-Dir-gern-wenn-Du-Dein-Bestes-dazugibst“-Gott!

      • Tamar von Siebental sagt:

        @ Rocket

        Gott hat den Menschen den Verstand und den freien Willen gegeben, sich zu überlegen ob er gutes oder schlechtes tun will. Es ist sein Wille dass gutges getan wird, aber ob das auch Ihr Wille ist, bestimmen Sie selber und nicht Gott. Sie entscheiden, ob Sie einer alten Frau über die Strasse helfen, oder ob Sie eine Frau vegewaltigen. Jeder Mensch muss sich für seine schlechten Taten selber rechtfertigen und dafür gerade stehen…………. irgendwann.

      • Blitz Blank sagt:

        @Rahel + @Tamar von Siebenthal

        „Gott hilft denen, die sich selber helfen“

        Sicher eine schöne „Gute Nacht Geschichte“…

        aber was ist mit denen, die sich nicht selber helfen können/konnten und zu unschuldigen Opfern werden/wurden. Was ist mit den zig Millionen industriell vernichteter Menschen der Nazis und Kommunisten?

        Können Sie mir erklären warum Gott denen hilft, die sich selber helfen, jenen aber nicht, die sich selber nicht helfen können?

      • Rocket sagt:

        „Es spielt vielleicht wirklich keine Rolle, ob Sie sich bekennen, solange Sie gutes tun, aber vielleicht kommt das Gute in Ihnen ja doch von Gott, nur wissen Sie es nicht.“

        Hehe, ich bin Gottes Werkzeug obwohl ich lästere? Na gut, wenn Ihnen dabei wohler ist…

        „Gott hat den Menschen den Verstand und den freien Willen gegeben, sich zu überlegen ob er gutes oder schlechtes tun will. Es ist sein Wille dass gutges getan wird, aber ob das auch Ihr Wille ist, bestimmen Sie selber und nicht Gott. Sie entscheiden, ob Sie einer alten Frau über die Strasse helfen, oder ob Sie eine Frau vegewaltigen. Jeder Mensch muss sich für seine schlechten Taten selber rechtfertigen und dafür gerade stehen…………. irgendwann.“

        Damit jemand (hier Gott) jemand anderem (hier Mensch) etwas geben kann, müssen beide existieren, einverstanden? Menschen existieren, ich glaube das würde niemand bestreiten? Existiert Gott?

        Wenn Gott den Menschen macht und es dem freien Willen des Menschen überlässt ob der Mensch Gutes oder Schlechtes tut, dann hat Gott selbst also die Möglichkeit geschaffen, dass Schlechtes geschieht, nimmt es also in Kauf. Das ist Ihr Gott, der höchstselbst das Schlechte in die Welt gebracht hat? Beim besten Willen, es ergibt einfach keinen Sinn.

        Behauptung:
        Gott existiert und er ist allmächtig.

        Es gibt vier Möglichkeiten

        1) Er will nicht dass Schlechtes geschieht und ist allmächtig

        2) Er will nicht, dass Schlechtes geschieht, ist aber nicht allmächtig.

        3) Er will, dass Schlechtes geschieht und ist allmächtig

        4) Er will, dass Schlechtes geschieht und ist nicht allmächtig

        1) Fällt weg, da offensichtlich trotz seiner Allmacht Schlechtes geschieht.
        2) Würde erklären warum trotz eines guten Gottes Schlechtes geschieht, verletzt aber die Annahme.
        3) Ein Horrorszenario. Aus ethischen Gründen dürfte man einen solchen Gott nicht verehren.
        4) Klingt nach Mensch und verletzt ausserdem die Annahme.

      • Rocket sagt:

        Es ist deshalb viel plausibler anzunehmen, dass mindestens eine der drei folgenden Aussagen verletzt ist:

        * Er will das Gute nicht (oder nicht nur)

        * Er ist nicht allmächtig

        * Er exisitert

      • Rocket sagt:

        Ich sollte mich entscheiden, ob ich etwas positiv oder negativ formulieren will, deshalb noch einmal, verständlich. Ignorieren Sie bitte obige Pfuscherei.

        Es ist plausibel anzunehmen, dass mindestens eine der drei folgenden Aussagen über Gott verletzt ist:

        * Er will nur das Gute

        * Er ist allmächtig

        * Er exisitert

      • Orlando S. sagt:

        @Rahel & @Tamar

        ihr seid erfrischend. Und überzeugend. ES ist schön zu wissen, dass es solche Frauen wie sie beide gibt!
        🙂

      • Rahel sagt:

        @ Blitz Blank

        Ich wollte es nicht so ausdrücken, dass Gott nur denen hilft, die sich selbst helfen können! Sorry, wenns so rüberkam! Eigentlich wollte ich, anhand meines Beispiels mit den Prüfungen unserer Kids, lediglich aufzeigen, dass uns Gott zur Seite steht bei Sachen, bei denen wir etwas aus eigener Kraft tun können und es aber auch wirklich tun ( also unsere Möglichkeiten vollumfänglich nutzen ) In unserem Fall würde das konkret heissen: fleissig lernen und dann dürfen wir Gott darum bitten, dass er den Rest zum Gelingen beiträgt ( ob ers dann auch wirklich macht, bleibt ihm überlassen ) . Sicher gibt es auch Situationen, in denen wir uns absolut nicht selber helfen können! Warum Gott in solchen Momenten nicht immer eingreift kann ich mit meinem beschränkten Menschenverstand nicht fassen, sonst könnte ich es Ihnen jetzt und hier erklären, aber das weiss nur er!

      • Rahel sagt:

        @ Orlando S.

        Ist das Ernst gemeint oder wie 🙂

      • Brunhild Steiner sagt:

        @Rocket: gute Annahmenaufstellung,
        das ist der Stoff aus dem bis-zum-Morgen-diskutiert-Nächte geschneidert sind
        (aber ich hab heut nicht die Zeit dafür)
        Das Moment der freien Willensentscheidung, und wie kann sich ein freier Wille zu „schlechtem“ entscheiden, wenn „Schlechtes“ gar nicht erschaffen wurde, jedenfalls nicht von der Oberinstanz?
        Wie ist es möglich (denn wenn wir dieses Szenario durchspielen, dann mit dem alten Drehbuch, einverstanden?), dass sich himmlische Wesen, also die Engel, auflehnen konnten und so Destruktives überhaupt erst in Existenz kam?
        Musste Destruktivität nicht zuvor schon erschaffen gewesen sein, quasi auf dem Regal wartend ob sich jemand für sie entscheiden würde? Und wenn dieser Jemand Destruktivität erschaffen hat, wozu das ganze Theater?

        Vielleicht kam sie aber tatsächlich erst durch auflehnendes Verhalten in Existenz?
        Und hat zur ganzen Geschichte mit Baum und Wahl zwischen Nichtessen oder dochessen geführt?
        Wäre es besser gewesen auf das Unternehmen Mensch zu verzichten, da zuviele unwägbare Unbekannten?
        Oder dann wenigstens mit Dauerzugriff auf seine Festplatte um der Allmacht zum Durchbruch zu verhelfen, so eine Art ferngesteuerter Mensch?
        Und wäre das dann Allmacht, seine Geschöpfe wie ein Puppenspieler tanzen zu lassen,
        sie nichts tun lassen was Puppenspielers Regeln zuwider ist?
        Oder ist schöpferische Allmacht zulassen können dass sich das Geschöpf widersetzt?
        Ihm ein Friedensangebot anbieten, aber nicht zur Annahme zwingen?

        Und das ist der Anfang, da kommen noch ganz viel mehr Fragen dazu und die Nacht wär eh zu kurz…

      • Eremit sagt:

        @Rocket
        Da gibt es m.E. noch mehr Fälle bei der Behautpung „Gott existiert und er ist allmächtig“.
        1) Er will nicht dass Schlechtes geschieht und ist allmächtig
        2) Er will nicht, dass Schlechtes geschieht, ist aber nicht allmächtig.
        3) Er will, dass Schlechtes geschieht und ist allmächtig
        4) Er will, dass Schlechtes geschieht und ist nicht allmächtig
        5) Er will nicht dass Gutes geschieht und ist allmächtig
        6) Er will nicht, dass Gutes geschieht, ist aber nicht allmächtig.
        7) Er will, dass Gutes geschieht und ist allmächtig
        8) Er will, dass Gutes geschieht und ist nicht allmächtig
        9) Er will nicht dass Schlechtes geschieht, lässt es aber bewusst zu und ist allmächtig
        10) Er will nicht, dass Schlechtes geschieht, lässt es aber bewusst zu ist aber nicht allmächtig.
        11) Er will, dass Schlechtes geschieht, lässt das Gute aber bewusst zu und ist allmächtig
        12) Er will, dass Schlechtes geschieht, lässt das Gute aber bewusst zu und ist nicht allmächtig
        13) Er will nicht dass Gutes geschieht, lässt es aber bewusst zu und ist allmächtig
        14) Er will nicht, dass Gutes geschieht, lässt es aber bewusst zu ist aber nicht allmächtig.
        15) Er will, dass Gutes geschieht, lässt das Schlechte aber bewusst zu und ist nicht allmächtig
        16) Er will, dass Gutes geschieht, lässt das Schlechte aber bewusst zu und ist allmächtig

        Die Unterscheidung zwischen Gut und Schlecht ist nicht immer so einfach wie es auf den ersten Blick wirkt. Etwas mag für eine Person etwas schlechtes sein, für eine andere Person hingegen ist es etwas gutes. Man nehme an Rocket verliert die Stelle und die Wohnung und lebt von nun an auf der Strasse. Er mag nun klagen warum Gott so etwas schlechtes gegen ihn zuliess. Eine andere Person hingegen mag sich freuen eine Stelle und eine Wohnung gefunden zu haben. Ist dies etwas schlechtes?
        Würde Gott hingegen und mit eiserner Faust jede noch so winzige Ungerechtigkeit bestrafen oder gar nicht erst zulassen, so hätte er nicht nur die Liberalen, die Freiheitlichen, gegen sich, sondern auch alle Egoisten welche gerne nach der Macht greifen. Das würde rasch zu einem Zustand führen wie bei der Schlacht der Engeln mit Gabriel gegen Luzifer. Letzterer war gerade eben mit den vorgegebenen Freiheiten nicht zufrieden und wollte mehr.
        Anders ist es bei uns Menschen. Wir haben die Möglichkeiten und Freiheiten uns über andere zu erheben und sie zu versklaven, psychisch und/oder physisch, und Gott schaut zu nicht ohne Grund. Für die einen mag es etwas schlechtes sein diskreditiert zu weden, für andere hingegen ist es etwas gutes, weil dadurch die anderen ihr niedere Gesinnung offenbaren. So kann es auch für Gott etwas „gutes“ sein im Hinblick auf das jünste Gericht.

  • Kim sagt:

    @ alle, vor allem aber Rahel, Tigri, Katharina, Pippi, mila, Mila, mira, fufi, Auguste, tobe, Sportpapi, heidi, Brunhild, Marcel, Hans

    Einige regelmässige KommentiererInnen hier sind mir in den vergangenen Monaten doch ans Herz gewachsen und ich werde eure Kommentare vermissen. Da ich nicht abschätzen kann, wie viel Energie ich in den nächsten Monaten für ausserfamiliäre Aktivitäten haben werde, lege ich das Kommentieren fürs Erste auf Eis, möchte aber nicht einfach den Laptop zuklappen, sondern mich offiziell für eine Weile verabschieden.

    Gestern habe ich, für alle überraschend, auch für die Ärzte, die Diagnose Brustkrebs erhalten. Nächste Woche ist die OP, ein paar Tage später wird man die Geburt frühzeitig einleiten und anschliessend werde ich über Monate mit Chemotherapie behandelt. Bis gestern Mittag war meine Welt noch in Ordnung. Ich will das schaffen und bündle darum meine Kraft auf das, was kommt, auch für meine beiden Kinder, das Neugeborene und meinen Mann. Gott sei Dank erfahren wir bereits jetzt von allen Seiten Unterstützung. Ich freue mich auch schon aufs Wiederkommen und Kommentieren, vielleicht im Sommer, vielleicht aber auch mal zwischendurch, wenn es mir gut geht. Wenn die/der eine oder andere Lust hat, Kontakt aufzunehmen, dann freue ich mich sehr, denn Mails werde ich sicher checken: quabi@gmx.ch

    Euch allen alles erdenklich Gute und weiterhin viel Spass beim Lesen und fleissig Kommentieren.
    Hoffentlich bis bald
    eure „Kim“

    • Rocket sagt:

      Ich bin zwar keiner der angesprochenen, aber ich wünsche Ihnen alles Gute. Ihre Diagnose tut mir sehr leid.

    • mila sagt:

      liebe kim, ich wünsche ihnen und ihrer familie alle kraft der welt. verzeihen sie die banalen worte, sie kommen jedoch von herzen.

    • StefanB sagt:

      Liebe Kim,
      Da kann ich nur sagen: alles Gute, und möge der, an dem viele zweifeln und mehrere leugnen, Dir und Deiner Familie die Kraft schenken, das durchzustehen, und Deinen Ärzten und PflegerInnen das Wissen eingeben, wie sie Dich heilen können.

      • Brunhild Steiner sagt:

        @Kim: vielen Dank fürs Wissenlassen, ich schliesse mich den Wünschen von StefanB an,
        und bin sehr froh dass die Unterstützung da ist und lebt, alles alles Gute!!!!

    • tobe or not tobe sagt:

      KIM WÜNSCHE DIR ALLES GUTE UND VIEL KRAFT! Du packst das gemeinsam mit Deiner Familie!

      Wir glauben an Dich.. Und melde dich wieder hier..

      Wir halten die Stellung für Dich….

      • rosi sagt:

        Kim, wir kennen uns zwar nicht. Da Sie aber hier so offen darüber sprechen, wünsche ich Ihnen von Herzen alles Gute, baldige und restlose Genesung! Ich hoffe, Sie bekommen alle Unterstützung, die Sie brauchen. Alles Gute auch für Ihre Familie und Ihrem Baby einen guten Start ins Leben.

    • Auguste sagt:

      hmm…, ich bin bestürzt über diese nachricht und wünsche ihnen von ganzem herzen, dass trotz solch niederschmetternder neuigkeiten alles gut gehen wird in den nächsten tagen.

      aus welchem holz frauen geschnitzt sein können, hat sie einmal wunderbar aufgeschrieben und vorgetragen:

      youtube: dolly parton – eagle when she flies

      …der zweite clip 4.13 ist der bringer. so, jetzt muss ich nochmal in die maske.

    • fufi sagt:

      Bhüeti Gott!
      fufi

    • Pippi Langstrumpf sagt:

      Liebe Kim, das ist ja eine schreckliche Nachricht, mir fehlen die Worte……..

      Von Herzen nur das Beste für Dich, Kraft, Mut und Zuversicht. Das Schöne trotz des Schrecklichen kommt ja, wenn Du Dein Kind in den Armen halten wirst, ich hoffe, dass Du dadurch diese Zeit auch positiv erleben kannst.

      Herzliche Grüsse

      Pippi

    • Kim sagt:

      Vielen Dank für eure lieben Wünsche. Es gibt noch viel zu organisieren. Vor allem die Betreuung der bald 3 Kinder ist noch ein Unsicherheitsfaktor. Aber wir wollen und werden das hinbekommen. Trotz Traurigkeit und Angst.
      Passt gut auf euch auf.

    • mira sagt:

      Liebe Kim, ich wünsche Dir ebenfalls viel Kraft und Durchhaltewillen für die kommende Zeit. Ich schicke Dir einen liebevollen Blick. Dieser soll Dich begleiten und Dir neue Energie geben, wenn es schwer wird. Und Freude, wenn es endlich wieder besser geht. Du schaffst das!!

    • Katharina sagt:

      Meine Gedanken sind mit Dir, Kim.
      Zu allererst wünsche ich Dir, dass Dein Kleines wohlauf auf diese Welt kommt. Deine Gesundheit wird höchstwahrscheinlich, so hoffe, ich , wieder kommen. Vergiss nicht dass Mind over Matter gilt. Und die moderne Medizin kann bei Deiner Diagnose viel helfen. Ein schwieriger Weg steh vor Dir, aber ich sehe dass dieser Weg einer des Wachstums und Erkenntnis sein kann.

      Herzliche Grüsse,

      Katharina.

    • Hans Mustermann sagt:

      Hallo Kim,
      da kann ich mich nur anschliessen und hoffe es geht alles gut und du bist schnell wieder hier.

  • Mike Shiva sagt:

    Soll ich euch eine Engelskarte ziehen?

  • Verena Hunziker sagt:

    Ich schliesse mich Herrn Koch an – Religion(en) sollten nur im Geschichtsunterricht behandelt werden. Religion ist Privatsache, es ist nicht die Aufgabe der Schule, den christlichen (oder einen anderen) Glauben zu verbreiten. Und was die Ethik anbelangt – die Bibel, auf die sich die christliche Religion und Ethik berufen, ist doch kein Buch der Gleichheit, Brüderlichkeit, der (Nächsten-)Liebe und Vergebung. Viele Geschichten handeln von Rache, Mord, Totschlag, Vergewaltigung oder Unterdrückung. In der Bibel liest man beispielsweise, dass die Frau dem Mann in jeder Hinsicht untertan ist, oder dass Eltern ihre Kinder umbringen sollten, falls diese ihnen nicht gehorchen. Und in der Sintflutgeschichte rottet der biblische Gott, ausser einer einzigen Familie, die ganze Menschheit aus – nach heutigen Massstäben ein globaler Genozid also. Ich würde meine Kinder niemals solch einen Mörder anbeten lassen.

    • Verena Hunziker: „In der Bibel liest man beispielsweise, dass die Frau dem Mann in jeder Hinsicht untertan ist,“ Könnten Sie mir dies mit Bibelstellenbelegen? Und Kennen sie historisch erforschte Gesellschaften in der Zeit 1200 v. Chr. bis 200 n.Chr. in denen die Frau mehr Rechte hatte als in der Bibel nach Verena Hunziker?

      • Globetrotterin sagt:

        Vor allem in der Zeit von 1200 v.Chr. bis 200 n. Chr. war die Bibel ja stets an der Spitze der Top-Ten der Bücherhitlisten zu finden!

      • Ted Nimel sagt:

        Kein Problem mit den Bibelstellen:
        Ihr Frauen ordnet euch euren Männern unter wie dem Herren. (Epheser 5:22-24)
        Und dein Verlangen soll nach deinem Mann sein, aber er soll dein Herr sein. (1.Mose 3:16)
        Und wie kann rein sein ein vom Weib geborener? (Hiob 25:4)
        ..um nur ein paar noch harmlose Beispiele zu nennen.

        Bezüglich der Gesellschaften (mal stark vereinfacht):
        – Bei den alten Ägyptern waren Frauen den Männern rechtlich beinahe gleichgestellt, im Ansehen sogar höher.
        Allerdings gelangten sie trotzdem nicht so oft in Machtpositionen.
        – Bei den Griechen wars unterschiedlich. Frauen waren nicht so im öffentlichen Leben vertreten, stark von Zeit und Staat abhängig, verwalteten grösstenteils das Heim.
        – Bei den Römern hing es vom sozialen Status ab, aber sie hatten mehr Freiheiten als die Griechinnen, konnten sehr mächtig werden aber nicht in die Politik. Gesellschaftlich hatten aber auch viele Männer eingeschränkte Rechte.
        – Bei den Kelten waren Frauen eigentlich gleichgestellt. Die Unterschiede hier waren vom sozialen Status abhängig.
        – Die Wikingerfrau herrschte über den Haushalt/Hof etc., konnte sich jederzeit Scheiden lassen, dann musste der Mann die Mitgift zurückzahlen, sogar die Araber wunderten sich über deren Macht.

        Allerdings war in all diesen Kulturen die Freiheit weit grösser als dann im christlich dominierten Mittelalter für die nächsten tausend Jahre! v.a. die für die damalige Zeit fortschrittlichen Frauenrechte der ‚Heiden‘ wurden regelrecht weggepusht, erst mit der Aufklärung erhielten Frauen wieder mehr Rechte.

        -> Von mir aus kann jeder Glauben was er will, aber historisch gesehen hat das Christentum eine grosse Zerstörung der damaligen Gesellschaft und Werten bewirkt. Weitere Punkte wären Bücherverbrennung, Religionszwang, Triebunterdrückung, Erbsünde.. DAS sind auch christliche Werte.

        -> Die westliche Welt ist heute nicht von christlichen Werten geprägt sondern von humanistischen. Gute Christen wissen das aber und haben kein Problem damit. Mann kann in jedem Glauben das gute finden.

      • Orlando S. sagt:

        Oder wars „Intellektuelle Argumente“ von der Autorin Globetrotterin? 467 S. leeres weisses Papier, gebunden, ca. 2.55.-

      • Globetrotterin sagt:

        „Man kann in jedem Glauben das Gute finden.“ – Natürlich. DAS wird ja auch stets GROSS hervorgehoben. Das BÖSE hingegen wird verniedlicht und unter den Tisch gewischt. Die kürzlichen Exzesse kennen wir ja alle zur Genüge. Der heutige Reichtum der Kirche ist nichts anderes als Blutgeld. Über dieses Tabu aber wird eisern geschwiegen. Und: Wer weiss schon von den Zwangsarbeitern im 3. Reich, die sowohl die evangelische als auch die katholische Kirche „beschäftigen“? Die systematische Frauenfeindlichkeit aller hierzulande amtierenden Kirchen wird genauso eisern negiert. Was mich immer wieder vom Sessel haut sind Frauen, die solchen Vereinen auch noch huldigen! Wie verblendet und indoktriniert muss frau sein, um davor die Augen zu verschliessen?! – Wie ich schon an anderer Stelle sagte: Als Frau Mitglied einer Kirche zu sein ist genau das Gleiche, als ob ein Farbiger dem Ku-Klux-Clan beitreten würde.

    • StefanB sagt:

      Wenn die brutalen Geschichten des AT der Grund sein sollen, nicht Religion zu unterrichten, dann ist aber auch das Dritte Reich (wegen der brutalen Folter und Vernichtung grosser Massen) kein Stoff für die Schule, ebenso wenig die Dekadenz des verblassenden römischen Reiches (Gatten- und Gattinnenmord, Inzest, Vergewaltigung, oder die Ermordung Tausender, die einem neuen Glauben anhingen, der die Mächtigen um ihre Macht fürchten liess).

      Wir sind, was wir sind, aufgrund der Geschichte, ebenso aber auch aufgrund der Überzeugungen, die wir in uns tragen.

    • Kathy sagt:

      Verena, hast Du schon mal vom neuen Testament gehört? Das gibt es auch noch…sehr empfehlenswert.

      Und um noch meine ehemalige Deutschlehrerin zu zitieren: „Wenn ich dürfte, würde ich euch alle zwingen, die Bibel zu lesen. Oder wie können wir sonst die grossen Werke bekannter Schriftsteller richtig analysieren!?“

      • Ted Nimel sagt:

        Naja so viele grosse Schriftsteller haben die Bibel wohl nicht persönlich gelesen…
        Aber die Idee ist toll, durch das lesen der Bibel (abseits der in der Kirche immer zitierten 30 Stellen) besteht eine grosse Chance zum Atheisten zu werden..

      • Orlando S. sagt:

        @Ted Nimel 17.33

        Die Bibelstellen – geschenkt! Wohl müsste man eine genaue Wortanalyse machen und feststellen, was Herr („Dominus“, Magister Domo) etc. in der relevanten Zeit für Bedeutung(en) hatte. Aber das ist nicht so ihr Ding, gell?

        Dafür aber, mein werter Herr: So eine schludrige, zusammenersonnene Aufstellung (Wikinger, Assyrer, bis zu den Griechen!) habe ich selbst hier noch nie gesehen. Einfach degoutant! Um mit Heidi Reiff zu sprechen: brrrrrrrrrrrrrrrrrrrr.
        Es kann ja jeder herkommen und schnell mal die Geschichte neu erfinden und Vermutungen anstellen („Allerdings gelangten sie trotzdem nicht so oft in Machtpositionen“).

        Entweder sie sind ein begabter Historiker, der diesen Fragen schon seit Jahren nachgeht und uns schnell einen Abriss gibt über seine Erkenntnisse (dafür ist ihre Ausdrucksweise etwas zu salopp). Oder sie sind ein Hochstapler, der die Geschichtsforschung mit einem Supermarkt verwechselt, wo man sich nach belieben mit Teil- und Volllügen eindecken kann um ein Süppchen zu kochen, das einem grad passt. Es ist so frech, dass es schon fast witzig ist.

        Aber es ist intellektuell unredlich. Vielleicht können sie damit Leute vom Schlage einer Globetrotterin beeindrucken, die sich ähnlich vage ausdrückt wenn sie von den (natürlich frei erfundenen) Hochkulturen berichtet, in der einst die Frauen das Sagen hatten.

      • Brunhild Steiner sagt:

        @Ted Nimel: diese Chance besteht insbesondere dann wenn man die gegebenen kulturellen Umstände der damaligen Zeit nicht in Zusammenhang mit dem beanstandeten Text setzen kann,
        ihn aus dem Kontext und Geschichtshintergund reisst,
        oder einfach wichtige Folgeverse unterschlägt wie bei der von Ihnen zitierten Epheserbriefstelle, wo’s nämlich mit der Aufforderung an den Mann, seine Frau so zu lieben wie Christus die Gemeinde geliebt hat (für die er mehr als bloss das letzte Hemd gegeben hat) weitergeht.
        Ja, es wurden von Machthabern Verse aus dem Zusammenhang gerissen und viel Unheil damit angerichtet, aber das liegt nicht am Vers, sondern am Menschen der Macht haben wollte.

      • Ted Nimel sagt:

        @Orlando S.:
        Nun, mein ebenfalls werter Herr, ich bin mir durchaus bewusst, dass die Zusammenstellung für einen Historikinteressierten nicht so geschliffen daherkommen.
        Aber wenn man Zusammenfassendes zusammenfassend wiedergibt, so dass jemand mit heutigem durchschnittlichem Geschichtswissen (also ca. keinem..) versteht kann sowas dabei rauskommen..

        Ich bin kein Historiker, befasse mich aber seit langem mit der Materie und wie Sie mich einfach so als einen Hochstapler beschimpfen empfinde ich jetzt mal als überhaupt nicht intellektuell (oder darf nur noch der studierte Experte über sein Thema reden heutzutage?)
        Sie unterstellen mir Schludrigkeit, doch konnten Sie noch nicht mal die Völker richtig wiedergeben (Assyrer.. wo rede ich von denn?)
        Statt auf irgend etwas einzugehen unterstellen Sie mir zu lügen. Aber es ist ja einfach jemanden des Lügens zu bezichtigen als auf irgend etwas einzugehen oder zu entkräften (weil man es nicht kann vielleicht..?)
        Meine Formulierung mag zwar etwas ungenau sein, stimmt aber im Sinn.

        Ich nehme gern ihr Beispiel:
        ”Allerdings gelangten sie trotzdem nicht so oft in Machtpositionen” -> Das ist weder neu erfunden noch eine Vermutung. Es ist erwiesen, dass im alten Ägypten Frauen selten in Verwaltungs/Beamtenpositionen vertreten waren, auch gab es nur eine Handvoll Pharaonninen im Gegensatz zu den unzähligen Pharaonen.

        Nun denn, wie schon gesagt stimmen meine obigen Aussagen verallgemeinert Betrachtet, würden Sie sich auskennen wüssten Sie das, anstatt meinen Intellekt in Frage zu stellen. Offensichtlich wissen Sie’s aber nicht darum frage ich mich welchen Sinn Sie dahinter sehen mich schlecht zu machen, wo Sie doch für ‚freie Diskussionen‘ eintreten.

        @Brunhilde Steiner:
        Trotzdem entwickelte sich Aufgrund der Bibel das Frauenbild der Christen. Und dieses kann man nicht absprechen.
        Und wenn eine Religion dermassen zur Macht etc. Missbraucht wird wie Sie das Formulieren, hat wohl die Religion, meiner Meinung nach, in ihrem Sinn versagt. Ich weiss nicht woher es kommt, aber gerade die Monotheistischen Religionen stechen ja mit einer Intoleranz gegenüber anderem Denken hervor wie keine anderen (Vielleicht liegts an so Sätzen wie ‚Keine Götter neben mir‘?).

      • Orlando S. sagt:

        Freie Diskussionen heisst nicht faktenfreie Diskussionen. Eben: Supermarkt. Ich wette, sie können mir alle Wikipedia-Einträge (selbstverständlich nur auf Deutsch) angeben, die sie für ihren Text verwendeten…
        Oh, ich bin auch für grobe Übersichten und die ganz grosse Sichtweise, aber der apodiktische Tonfall in ihrem Beitrag gepaart mit ihrem Hang zu p.c.-Mainstreamtauglichkeit – neh, geht gar nicht!
        Sie bestätigen meine Befürchtungen: ein „Historikinteressierter“ der sich schwadronierend einen Reim auf historische Vorgänge im luftleeren Privatraum macht.

      • Brunhild Steiner sagt:

        @Ted Nimel: das stimmt eben nicht ganz, bloss weil auch sehr viel Schlechtes damit gemacht wurde und fehlinterpretiert disqualifiziert das noch lange nicht den grundlegenden Inhalt.
        Diesen Wesenszug lässt sich nämlich querbeet überall festmachen!
        Und es waren auch längst nicht „alle“ Christen welche den Vorgaben aus den Machtzentralen gefolgt sind.
        Was mich auch stört ist die komplette Ignorierung von allem Konstruktiven, ganz viele soziale Errungenschaften welche für uns heute so selbstverständlich sind wurden unter selbstlosem Einsatz von „Christen“ ins Leben gerufen. Von der Witwen- und Waisenversorgung über Einsatz und Hilfsdiensten/Hilfswerken für Benachteiligte, Arme, Kranke, Randständige ganz egal welcher Rasse und Glaubens bis zur Gefangenenbetreuung.

      • marcus sagt:

        orlando, steiner & co.: aha, also manchmal kann man die bibel wörtlich zitieren, manchmal muss man den kontext, den urtext etc. mitbeachten, vielleicht ist die übersetzung auch ungenügend, …., damit der richtige gewünschte sinn entsteht. ihr habt da eine wahrscheinlich unbeabsichtigte antwort mitgeliefert, danke bestens.

      • Brunhild Steiner sagt:

        @marcus: und wo genau liegt darin das Problem?
        Ja, es muss jeweils differenziert werden, im Übrigen ist mir auch bei „Originalzitirereien“
        das Wissen um den Kontext wichtig.
        Und noch was zur Frauenunterdrückung, die reformierten Landeskirchen haben lange vor der Abstimmungsbevölkerung den Frauen in ihren Gremien das Stimmrecht zugestanden… .

  • fufi sagt:

    Es gibt leider noch viele, sehr viele Menschen auf dieser Welt, – einige Millionen wenn nicht eine Milliarde – die sich einen Dreck um Ethik oder humanistische Werte oder so kümmern. Das sind nämlich diejenigen, die tagtäglich ums nackte Ueberleben kämpfen.
    🙁

    • Orlando S. sagt:

      Heute Mittag sang am Radio der Milchmann Tevje: „Es ist keine Schande arm zu sein, aber auch keine besondere Ehre“.

      • fufi sagt:

        Nichts verstanden?

      • Orlando S. sagt:

        if I were a rich man, didldidldadldideldideldadeldei

      • heidi reiff sagt:

        Solange Menschen ihre NAHRUNG auf dem Müllhaufen ergattern müssen ist nichts in Ordnung, sollen diese Bischöfe doch mal ihre Mitras auf dem Kopf ausziehen, Tiaras, Diadems, Kronen, der Vatikan ist eine Maffia, oder die UBS die Goldbarren mal rausrücken, Fakt ist Vermögen kann kein Mensch mit
        nehmen ins Grab, Tod ist endgültig. So wie ich geschichtlich informierte bin, wurden Pharaonen samt Vermögen begraben. Kann ja sein, dass ich da aus div. Informationsquellen fehl informiert bin.

        Religionsunterricht finde ich sollte für alle Kinder ein Freifach sein, Kinder passen sich ja meistens an, weil ihnen nichts anderes übrig bleibt zum Ueberleben, im Alter von 6 Jahren können sich Kinder nicht entscheiden. Ich hatte einfach das Glück im Reli Menschen zu begegnen mit Humor, Nonnen und auch Vikare, kann heute Schmunzeln über eine Nonne, die uns das „Vaterunser“ mit dem Taktstock eintrichterte in dem sie mit dem Lineal auf den Tisch klopfte. Ich schätze das kleine Land CH , bin hier geboren, eine ewige Buenzlifrau , dumm auf die Welt gekommen und nichts dazugelernt,tztztztztz, wäre ev. die Lady Gaga meine letzte Rettung aus der Not, schätze hier nach wie vor Rettungsdienste 143 , Feuerwehr war mal früher Notnummer 118, es sind Menschen die sich engagieren nach ihren Möglichkeiten eben Humanismus gekoppelt mit Empathie, hat ja nichts zu tun mit Markenjeans oder Dior. Der Maler Dali hat ein Bild gemalt ein brennender Giraffe, Bilder sind einfach Aussagen von Menschen gehört ja zum Lebendigen Dasein im hier und jetzt. Askese ist nicht mein Ding, Sodom und Gomorra aus der griechischen Ecke auch nicht, ich bin dabei Bigotterie zu entsorgen, schaffe mir da mal langsam Zeit und Raum,bin froh, dass ich endlich mal meine Ruhe habe, schätze trotzdem div. Foren, einfach Meinungen von anderen Menschen, bin froh dass hoffentlich das Mittelalter vorbei ist mit diesen extremen SADISMEN UND RAECHERMECHANISMEN. Gruss noch von Giordano Bruni, kleiner Trost für Esoterikgläubige, Giordano Bruni war in meinem frühere Leben mein Zwillingsbruder, keine Hexensuppen bitte, Giordano Bruni war ein Rebell, ist Kuscherei IN . Ich kuschle mich jetzt ins Bett, ich hab einfach nicht alles im Griff. Bin eine extreme Chaotin, ist nicht tödlich, geht auch ohne Jeanne d’arc zu sein oder Winkelried. Manchmal bin ich recht stur, kann vielleicht einfach nicht landen mit meinem extremen Gerechtigkeitsgefühl oder habe ev. Angst als letzte Hexe auf dem Scheiterhaufen zu krepieren. Sorry für mein Geschwafel mein Stuss, manchmal sehe ich vor lauter Bäume den Wald nicht mehr oder umgekehrt, bin trotzdem mir treu geblieben, kritisch optimistisch, ist auch ein Weg,
        Allen viel Spass beim Suchen, warum denn in die Ferne schweifen………

      • tobe or not tobe sagt:

        @Heidi Reiff: göttliches Geschwafel oder nicht?

        der Vatikan ist definiitiv eine mafia und die Bischöffe kleine Teufelsanbeter…!

    • Rahel sagt:

      @ Orlando S.

      „Fiddler on the roof“……….i schon weiss 🙂

      • fufi sagt:

        aber er hat’sglaub immer noch nicht verstanden ..
        🙁

      • Ted Nimel sagt:

        @Orlando S.:
        Na dann befinden wir uns ja beide im selben Boot, Sie urteilen genauso Faktenfrei über mich.
        Was müsste ich dann tun damit mein Geschreibe nicht ‚faktenfrei‘ ist?
        Reicht es intellektuelle Fremdwörter einzustreuen wie Sie es tun? Tut mir leid aber ich brauche das eigentlich nicht für mein Ego und mir ists recht wenn mich mein Gegenüber auch ohne Wörterbuch versteht.
        Und ja ich stürze mich etwas gerne in extreme Formulierungen bin aber auch bereit mich widerlegen zu lassen usw. aber Sie wollen ja gar nicht mit mir reden, Sie greifen mich einfach nur persönlich an.

        Fangen wir doch nochmal von vorne an, meine Antwort bezog sich auf:
        „Und Kennen sie historisch erforschte Gesellschaften in der Zeit 1200 v. Chr. bis 200 n.Chr. in denen die Frau mehr Rechte hatte als in der Bibel“
        -> Ja die gibt es und das lässt sich Nachweisen (durch Fachmaterial!)

        und jetzt sagen Sie mir was sie an der Aussage stört?

        @Brunhild Steiner:
        Ich bin mir des Konstruktiven sehr wohl bewusst. Vor allem für die Leistungen der frühzeitlichen Klöster empfinde ich grossen Respekt
        Aber auch diese Dinge müssen wieder im Kontext gesehen werden.
        Religionsmissbrauch aber auch Selbstlosigkeit sind keine Erfindung der Christen.
        Meiner Meinung nach sollte Wertevermittlung ohne ‚Ballast‘ erfolgen. Die Bibel (und auch andere Bücher d. Religionen) muss interpretiert werden und beinhaltet Dogmen darum finde ich Sie ungeeignet. Gerne können Aspekte des Christentums als Beispiel herangezogen werden aber es darf nicht etwas als Grundlage gelten wo auch eine hohe Missbrauchsgefahr besteht.

  • Orlando S. sagt:

    In dem bemerkenswerten SciFi-Streifen „Contact“ (1997) streitet sich die Astrophysikerin mit dem Geistlichen. Dazu muss man wissen, dass der Vater der Wissenschaftlerin sie nach dem Tode der Mutter allein aufzog und bei einem Unfall starb, als sie noch ein Mädchen war. Sie sagt also zum Geistlichen:

    „Wenn es einen Gott gibt: beweisen sie es“
    „Liebten Sie ihren Vater?“
    „Ja, warum?“
    „Beweisen sie es!“

    Nach jüdisch-christlicher Überlieferung ist ER allmächtig. Hiesse das nicht auch, dass alle Versuche, seine „Existenz“ (oder Nichtexistenz) zu beweisen wie ein Naturphänomen oder eine philosophisches Konsruktion, scheitern müssen? Das wäre also eine Sackgasse.

    • Der mächtigste Gottesbeweis ist der Lärm, den die Atheisten seit Jahrhunderten vergeblich veranstalten.

    • fufi sagt:

      @Orlando
      Bin (ausnahmsweise?) absolut mit Ihnen einverstanden!
      Die Existenz Gottes kann – mit „menschlichen Mitteln“ nicht bewiesen werden und wird auch nie bewiesen werden können.
      Bloss: Die NICHT-EXISTENZ Gottes auch nicht!
      Also: Auf zum GLAUBENSKRIEG?
      Oder was denn?
      🙁

      • fufi sagt:

        Hoffe aber, dass wir zuvor die StGw’s im Zeughaus abgeben (Zeughaus= Haus, wo so Zeug’s hingehört!)
        😛

      • Benjamin Hitz sagt:

        Agnostizismus heisst die Lösung. Akzeptieren, dass es Ungewissheit gibt und diese auch aushalten können. Mit dem Christentum lässt sich da ja auch gut zusammenleben (wenn nicht gerade irgendwelche sich als Kirche – ob reformiert oder katholisch ist da einerlei – bezeichnenden Spinner sich zur Macht aufschwingen), da es ja vor allem die Werke sein sollen, auf die es ankommt und im Bezug auf den Glauben, diesen jeder für sich selber finden soll, weil Gott ja nichts mehr liebt als die Sünder, die reuig zu ihm finden.
        Mit anderen Glaubensbekenntnissen wird es da ja schon schwieriger und diese sind dann auch nicht zu schüchtern, den Glaubenskrieg einseitig aufzurufen, aber diese Diskussion hatten wir ja in einem anderen Thema (Freysingers Schul-Blues) schon mal.

      • Agnostiker sind die einzigen Realisten… da können sich Religiöse ein Stück Wahrheit abschneiden. Ein ganz dickes sogar!

      • christine sagt:

        GLAUBE IST DIE EMPFINDUNG DES WISSENS (novalis)
        diesen satz finde ich wunderbar: schulen wir unsere empfindungen!

    • Orlando S. sagt:

      Kein Glaubenskrieg, wenn schon ein Kreuzzug, wie im 1096i. Kommen Sie fufi, sie als Adhemar de Monteil, Giorgio als Papst Urban II und ich als der rasende Roland (Orlando Furioso) aus der Sage.

      Von Clermont nach Jerusalem! Deus lo vult!

    • Lukas Gloor sagt:

      Der Vergleich mit der Liebe hinkt gewaltig. Man sieht Indizien davon überall: In den Gesichtern der Leute kann man Spuren davon herauslesen (in Form von Trauer oder Zuneigung); gewisse Aktionen (Zärtlichkeit, Romantik, Selbstopfer etc.) drücken Liebe aus; und, wenn man wirklich auf Nummer sicher gehen will, kann man sogar einen Gehirnscan anordnen und sehen, ob die richtigen Areale aktiv sind wenn man an eine gewisse Person denkt.

      Für Gott gibt es (soweit ich weiss) keine solchen Indizien — wohl aber für die ‚Liebe zu Gott‘, was man natürlich nicht mit einem Gottesbeweis verwechseln sollte. Man kann nämlich sehr wohl über Dinge reden / nachdenken, die es nicht gibt. Das Argument ‚Gott kann man nicht beweisen‘ scheint doch sehr verdächtig: Falls es Gott nicht gibt, würde ich als Gläubiger sofort auf dieses Argument zurückgreifen und den ‚blinden Glauben‘ (faith) zur Tugend erklären. Ich sehe absolut keinen Zusammenhang zwischen der (selbstwidersprechenden) definition von ‚allmächtig‘ und dem ‚unbeweisbar‘ sein. Falls Gott irgend etwas bewirkt, kann man das theoretisch nachweisen. Bis jetzt wurde das nicht getan, und der nachgesagte ‚Wirkungsbereich‘ Gottes flieht weiter vor der Wissenschaft in die ‚Lücken‘, welche kleiner und kleiner werden. Das Konzept ‚Gott‘ ist eine schlechte Art, die eigene Unwissenheit zu kaschieren. Ehrlich wäre es, einfach zuzugeben, dass man nicht alles weiss.

      Aber das Problem hier ist sowieso ein anderes: In der Kritik am Fach R&K geht es nicht primär darum, ob die Religionen falsch sind. Das Problem ist, dass sie voreingenommen dargestellt werden, quasi aus Sicht einer rosa Brille, und dass die Alternative (nicht religiös sein) nicht erwähnt wird. Man tut so, als ob alle moralischen und gesellschaftlichen Werte aus der Religion kommen müssen, was offensichtlich nicht stimmt. Wenn man die Religionen und ihre Alternative objektiv darstellen würde, hätten wohl die Wenigsten ein Problem damit.

      • Rocket sagt:

        Hirnscans sind etwa gleich esoterisch wie Gott. Wenn sie die Betenden scannen werden sie auch gewisse Areale aktiviert sehen. Intensives Beten lösst die gleichen physiologischen Effekte hervor wie ein Orgasmus, hohe sportliche Anstrengung, laute Lieblingsmusik oder andere sog. Flowerlebnisse. Weder hat ein starker Orgasmus etwas mit viel Liebe zu tun (als notwendige Bedingung) noch ist eine Gotteserfahrung mit der Existenz Gottes gleichzusetzen. Autostimulation ist das Stichwort.

      • Karin Gut sagt:

        Die Geschichte lehrt uns, dass bisther jede Hochkultur den Drang verspürte, ihr Sein in Beziehung zu irgend etwas Göttlichem zu stellen. Und die entsprechende Reiligion ist dann das, was aus dem (geistigen) Kontakt Göttlichen-Irgendwas resultierte. Das Problem ist nur: Warum sind nicht schon die Maya’s auf Allah gestossen? Warum verehrten nicht schon die Austaliens Aborigines Zeus oder Jahwe? Warum haben alle immer wieder einen neuen Gott gefunden mit neuen Schriften und Geboten, mit einem anderen Himmel und einem anderen Jenseits? Dass die Menschen nicht zweimal unabhängig voneinander auf den gleichen Gott gestossen sind, lässt nur einen Schuss zu: es ist alles eine Illusion. Der „Gott“ der immer dazu sein scheint und doch nie fassbar ist, ist nur eine Illusion.

    • Orlando S. sagt:

      Und wieder denken sie in die 180Grad falsche Richtung. Es geht um die Liebe Gottes, nicht um die Liebe ZU ihm.

      Und „die Liebe“, die sie mit ihren Gehirnscans messen und in einen Systemzusammenhang drücken wollen, ist nocheinmal etwas anderes.

      „Falls Gott irgend etwas bewirkt, kann man das theoretisch nachweisen“ – sind sie je vor dem Kölner Dom gestanden?

      • fufi sagt:

        Orlando!
        Seit wann sind wir wenigstens teilweise derselben meinung?
        a) Klar geht’s um die Liebe Gottes ZU den Menschen
        b) aber „Gottes Wirken“ kann ebensowenig nachgewiesen werden wie Gottes Existenz.
        Also
        🙂
        🙁

    • mila sagt:

      zu diesem resultat ist man bereits im 18. jahrhundert gekommen, nachdem die vielfältigen versuche des 16. und 17. jahrhunderts, die göttliche existenz in den erscheinungen der natur nachzuweisen, gescheitert sind (phyikotheologie nannte sich dieses unternehmen, und es trieb im übrigen auch noch geistige grössen wie isaac newton umher). seitdem ist klar, dass theologie und wissenschaft prinzipiell verschiedene disziplinen sind, deren methoden sich gegenseitig ausschliessen. ende der debatte. wenn die menschen doch nicht nur so geschichtsvergessen wären… auch dem intelligent design ist hiermit im grunde schon jede grundlage entzogen.

      • mila sagt:

        ging übrigens an den ersten eintrag von orlando s.

      • Orlando S. sagt:

        sie beenden gerne Debatten, nicht wahr mila? 🙂

        Ich kenne mich da nicht so aus, aber sind Evolutionstheorie und die neue Strömung Intelligent Design nicht vielmehr Versuche, die Mechanismen zu erklären, wie sich das hier alles entwickelt hat? Über den Anfangsimpuls und darüber, was vorher war, geht es gar nicht.
        Intelligent Design geht einfach mit der Hypothese davon aus, dass sich ein Schöpfergott das Leben und alles auf der Erde geschaffen hat, wie der Mensch sich Werkzeuge schafft. Aber sie versucht dies mit den Mitteln der Wissenschaftlichkeit und nicht mit den Mitteln der Theologie.
        Es hat nichts mit geschihtsvergessenheit zu tun, viel eher damit, dass seit dem 16. Jahrhundert ich die Methodik und Instrumente doch schon weiterentwickelt hat. Eun neuer Versuch kann ja nicht schaden, oder?

      • fufi sagt:

        mila:
        Wo du recht hast, hast du recht!
        Interessant ist mit Blick auf die „intelligenten Designer“, dass sie erstens alle älteren(!) Schöpfungserklärungen(Ugaritisch, hethitisch, australisch-aboriginell) als „abergläubischen Humbug“ abun, ihrereseits aber behaupten, die Welt (=das Universum) sei so ungefähr vor 7400 Jahren(5400 a.c.) vom lieben Gott erschaffen worden.
        Mitsamt den Dino- und allen anderen Fossilien, und den radioaktiv zerfallenden Elementen und so. Da scheint uns der „liebe“ Gott aber ganz schaurig über unsere eigeneGeschichte täuschen zu wollen. Der „liebe Gott“?
        Aber eben, es soll Menschen geben, die nur glauben wollen, was sie sehen, und es soll Menschen geben, die glauben, dass sie nichts sehen wollen und es soll Menschen geben, die sehen, was sie nicht glauben wollen und es soll Menschen geben, die nicht glauben wollen, was sie sehen.
        Interessant scheint allerdings, dass extrem viele „Intelligente Designer“ gerade Ingenieur-(=Designer)Berufe ergreifen.
        Ob sie denn sein möchten wie Gott?
        🙁

      • Orlando S. sagt:

        @fufi the Preach: gebe es ungern zu, aber es hat mal Hand und Fuss, was sie sagen! Res-pect!

      • mila sagt:

        @orlando s.: die physikotheologen waren – im gegensatz zu den heutigen intelligent design-leuten, die ihre eigene vergangenheit nicht kennen – überaus schlaue köpfe, insofern ist es eine ironie der historie, dass es gerade ihre versuche waren, die dazu geführt haben, dass man physische und metaphysische betrachtungen nachfolgend voneinander trennte. die wissenschaft masste es sich nicht mehr an, über religionsfragen zu entscheiden (wobei, heute glaubt sie, es wieder tun zu müssen), und die theologie hielt sich aus der wissenschaft raus. intelligent design kann nur ernst nehmen, wer zugleich diese trennung von physik und metaphysik wieder aufheben will – und das wollen sie doch nicht? 🙂

        @fufi: hihi, so kann man das ganze natürlich auf eine weit amüsantere art klarstellen, respect auch von mir.

  • mostindianer sagt:

    wo ist fufi, wenn man ihn braucht?

    • Nun, das ist wohl das Gebiet, in dem er die tödliche Blamage fürchtet. Nach dem Muster „hättest du geschwiegen, wärst du ein Theolog geblieben“.

      • fufi sagt:

        Nun ja, Herr Girardet!

        Irgendwie wär’s mir ja wirklich zu blöd, mich auf solch idiotische Spiele einzulassen.
        Wenn da nicht Menschen wie zum Beispiel Jeremia und Jesus gewesen wären.
        Die haben nämlich auch keine tödliche Blamage gefürchtet!
        Oh God!

    • fufi sagt:

      Keine Angst, fufi das Photon befindet sich mit c auf dem Weg zum Mamablog!
      Lasst dem armen kleinen Kerlchen doch wenigstens die Zeit, den Blogtext und die zurzeit 328 Kommentare zu verdauen?
      Many Thanks
      😛

      Ach ja, Herr G.G.
      Gerade Sie sollten eigentlich wissen, dass Geplapper höchstens zu Silber reicht?

    • fufi sagt:

      ach ja, fufi musste sich zuvor noch mit dem leidigen geld-verdienen beschäftigen!
      🙁

  • Markus Schneider sagt:

    Der Jugend müssen die Werte des Christentums ganz genauso dringend vermittelt werden wie die Werte des Islams, des Buddhismus, des Kommunismus oder die des Nationalsozialismus. Und zwar ganz einfach deshalb, damit die kleinen Nichtswisser verstehen, wovon die Grossen überhaupt reden. Dabei werden sie schnell merken, dass unter den Grossen die meisten ausser den Worten selber rein gar nichts verstehen. Aber getan wird natürlich stets so, als hätte man sich eingehendst mit fremden Religionen oder Weltanschauungen beschäftigt und wüsste darum auch jederzeit, wann Toleranz angebracht ist und wann nicht.

  • Anthony Stroppel sagt:

    Nicht nur die Christliche Religion jedwede Religion soll von der Schule fliegen es soll nach Möglichkeit auf keinerlei „Rekrutierung“ an der Schule stattfinden können.

    • Auguste sagt:

      hmm…, sobald man eine andere zeitung verstehen will als nur gerade 20-minuten, ist man schon froh um ein paar rudimentäre religionskenntnisse.

  • Nemo sagt:

    Frau Biswanger grundsätzlich grundsätzlich schätze ich Ihre Beiträge sehr, auch diesen. Nun kommt aber das obligate „Aber“.
    Wenn Sie sich die Mühe genommen haben die vom Hombrechtiger Vater beanstandende Aufgabe zu lesen, dann wäre Ihnen sicherlich aufgefallen, dass dies einem Indoktrinationsversuch sehr nahe kommt, wenn nicht gar erreicht wird. Und ich fnde die Reaktion des Vaters nicht extrem oder gar extremistisch.

    Religion mag für viele Menschen wichtig sein und der gute alte Giorgio Girardet mag sich in diesem Thema ereifern und zwischen seinem historischen Wissen auch noch einige Beleidigungen fallen lassen, von mir aus. Aber Aufgabe der Schule ist es die verschiedenen Religionen zu erklären und auch die Alternative der Religionslosen aufzuzeigen. Ist dies zu viel verlangt, gehört dieses Fach ersatzlos gestrichen.

    Religion ist Privatsache. Wir sollten endlich so weit sein, dass sich niemand für seine Religion oder eben Nichtreligion zu rechtfertigen braucht. Weder brauche ich religiöse noch atheistische Missionare. Und ich brauche auch keine staatliche Schule die meine Kinder zu Gläubigen erzieht. Das entscheide ich und wenn sie alt genug sind, können sie dass auch selber korrigieren.

    • Lieber Nemo. Die Zürcher evangelisch-reformierte Zürcher Landeskirche verliert kontinuierlich an Mitgliedern. Das letzte Mal, dass sie Mitgleider gewann, war zwischen 1936 und 1945. Offensichtlich ist die Neigung zur „Vernunft“ von gewissen historischen Stimmungslagen abhängig. Es mag ein verbreitete Vorstellung sein, es liesse sich Staat und Religion trennen. Der römische Kaiser Konstantin war 325 anderer Ansicht als der die Christen zwang eine Glaubensplattform zu formulieren (Niceanisches Bekenntnis), die bald zur Staatsreligion wurde. Gerade der „Bund“ der „Eidgenossen“ ist eine Konstruktion, die man nur sehr schwer von ihrem regligiösen Mutterkuchen trennen kann. Ihre Ansicht, dass Religion gänzlich „privat“ sein kann ist nicht nur unrealistisch, sondern auch gefährlich. Sie gefährdet den historisch errungenen Religionsfrieden und das komplexe Gleichgewicht des Schweizerischen Staatskirchenrechts. Oder folgende Fragen:

      1. sollen wir auf das „Schweizerkreuz“ verzichten?
      oder zuhanden der muslime eine Erklärung bei der UNO deponieren, dass unsere Staatsflagge „gar nichts mit Religion zu tun“ habe, wie die Ober-Freidenkerin Reta Caspar nicht müde wird zu behaubten?
      2. soll auch das „rote Kreuz“ ein anderes Symbol wählen? wenn ja, welches?
      3. Sollen Atheisten einen andere Nationalhymne bekommen, die nicht „Schweizerpsalm“ heisst?
      4. Werden wir eine Mehrheit finden, eine Verfassung durch die Volksabstimmung zu bringen, die nicht mit „Im Namen Gottes des Allmächtigen“ beginnt?
      5. Sollen wir auf den *Hohen kirchlich/staatlichen Feiertag“ den „Eidgen. Dank-, Buss- und Bettag“ (in moderner Version seit 1832, voher seit 1517) abschaffen?
      6. Sollen wir die christlichen Konfessionen als privatrechtliche Vereine oranisieren? Sollen die Kirchen nicht mehr öffentliche Gebäude sein, sondern private „Clubräume“ „for members only“ wie der Fitness-Club?

      Das wären alles konkrete Fragen, auf die ein „Religionsprivatisierer“ ein Antwort geben müsste.

      • Auguste sagt:

        hmm…, zu punk 1: sind sie wahnsinnig geworden, giorgio? wissen sie eigentlich, was so ein original nationalmannschafts-trikot kostet? zu punkt drei: jetzt wo hitzfeld’s multikulti-truppe nach jahren qualvollen übens endlich die erste strophe auswendig singen kann, kommen sie mit so einer idee – wir blamieren uns schon bei den penalty-schiessen genug. das jeder noch ein anderes lied singt vor dem match, muss nicht auch noch sein! und was aus öffentlichen gebäuden wird, die von „members only“ finanziert werden, sieht man ja am hardturm-stadion ganz deutlich. solche ruinen sind dem mittelländischen ortsbild doch eher abträglich.

      • Globetrotterin sagt:

        Das ist der Auguste, den ich mag.

      • Blitz Blank sagt:

        1. Wer sieht schon in der Schweizer Flagge einen hängenden Christus? = keiner = irrelevant.
        2. Ändert ein anderes Symbol etwas an der Arbeit des Rote Kreuzes? = Nein = irrelevant.
        3. Wer kennt schon den Text des Schweizerpsalms? = nahezu keiner = irrelevant.
        4. Ja 100%
        5. Beibehalten und in eidg. Besinnungstag umtaufen.
        6. Nein. Die Kirchen, die im staatlichen Dienst stehen, müssen als Entgelt für ihre Privilegien (Steuererhebung) Leistungen für die Gesellschaft erbringen.

      • Nemo sagt:

        Lieber Giorgio Girardet
        Gut und jetzt? Es kümmert mich eigentlich nicht ob die evangelisch-reformierte Landeskirchen Mitglieder verlieren oder gewinnen. Was mich kümmert ist, dass sich kein Mensch in der Schweiz bezüglich seinem Glauben oder seiner Religion zu rechtfertigen hat. Auch ist es mir ein Anliegen, dass der BV Art. 15 eingehalten ist und die staatliche Schule nicht versucht die Kinder zu indoktrinieren. Dies ist aber im erwähnten Hombrechtiger Fall nicht auszuschliessen. Zudem ist die Religion und damit die Ausübung Privatsache. Dies hat aber mit der Organisationsform der Landeskirchen nichts zu tun.
        Was Sie ganz genau mit Ihren Fragen bezwecken verstehe ich nicht ganz, aber wenn es Ihnen am Herzen liegt, kann ich Ihnen diese gerne Beantworten. Nur zur Vorbemerkung, ich habe in meinem Text keine Symbole in Frage gestellt, sondern die Aufgabenstellung im Hombrechtiger Fall.
        1. Warum soll genau das Schweizerkreuz in Frage gestellt werden, es dient ja keinen missionari-schen Zwecken und den wenigsten ist der historische Zusammenhang für die Entstehung be-kannt. Warum drängen Sie mich in die Ecke der Freidenker?

        2. Neben dem roten Kreuz gibt es auch den roten Halbmond und den roten Davidstern. Meines Wissens betreibt keine dieser
        Organisationen missionarisch Arbeit und helfen den Menschen unabhängig vom Glauben. Warum sollte dieses Symbol geändert werden?

        3. Nicht nur die Atheisten auch die Gläubigen hätten eine würdigere Nationalhymne verdient und hätten ein Anrecht auf einen musikalischen Läckerbissen. Sorry der Saloppe Ausdruck aber der Schweizpsalm ist Müll, aber so what.

        4. Ja, sofern das Parlament dies gewollt hätte, wäre auch eine solche Verfassung angenommen werden. Da die Präambel keine wirkliche Bedeutung für mein Leben hat, ist mir das egal. Sie kann auch im Namen des Spagethi Monsters beschlossen werden.

        5. Solange ich nicht damit belästigt werden, was ich ja nicht werde, kann dieser Tag auch belassen werden. Es interessiert sich ja praktisch niemand dafür

        6. Die meisten christlichen Konfessionen sind ja bereits privatrechtlich organisiert, wenn sie aber die 3 Konfessionen ansprechen die als Landeskirchen anerkannt sind, so ist mir das so lang wie breit, solange sie keine Agitation in öffentlichen staatlichen Einrichtungen tätigen. Davon sind die Kirchen oder ähnliche Einrichtungen, in welche jeder freiwillig Eintritt und damit rechnen muss, ausgenommen

  • the man sagt:

    Was mich immerwieder ärgert (auch in zahlreichen Wortmeldungen hier!): Als religiöser Mensch wird man oft von „razionaleren“ Zeitgenossen als dumm, rückständig und abergläubisch betitelt, im schlimmsten Fall ist man noch Komplize der Hexenverfolgungen und der Kreuzzüge.
    Meinerseits respektiere ich alle Atheisten, Agnostiker und Freidenker. Ich bin mir sicher, dass sie keine schlechteren Menschen sind, sich genauso viel Gedanken über ihr Leben machen und sich genauso verantwortunsvoll verhalten wie alle anderen. Schlussendlich versuchen wir das Beste aus uns und unserem Leben zu machen. Wenn die Lektüre von Camus oder Kant jemandem dabei hilf, dann soll dafür Platz in der Schule sein – wenn es jemandem hilft, wenn er die Bergpredigt liest, soll auch das möglich sein.
    Warum versuchen gewisse Leute alle Religionen mit aller Kraft zu bekämpfen?

    • Roman Günter sagt:

      Das Problem liegt wohl eher dort, wo es für die Einen (religiösen Menschen) keine Diskussionsbasis mehr gibt und wo für die Anderen (Agnostiker) die Diskussion erst anfängt interessant zu werden. Dazwischen gibt es natürlich auch massenweise unflätige Personen. Die Aussage, dass es Gott gibt, kann genauso arrogant sein wie die Aussage, dass es Gott nicht gibt. Zweifellos richtig ist, wenn wir uns gegenseitig respektieren.

    • fufi sagt:

      @ the man

      Es isch nämli viel, viel, viel schlimmer, Menschen aus religiösen Gründen in die Armut zu treiben – sonstwie zu vertreiben – zu foltern – zu töten als aus wirtschaftlichen, politischen, nationalistischen oder sonstwelchen ideologischen Gründen.
      Haben Sie das denn noch immer nicht verstanden?
      🙁

      • Patrick sagt:

        Nun, fufi, was ist der prinzipielle qualitative Unterschied von Religion und Ideologie?

      • fufi sagt:

        Ach Patrick, willst du’s mir denn glauben wollen?
        Also:
        Denke im Namen von Religionen wurde viel viel mehr Gutes getan als im Namen von Ideologien.
        Im Schlechten stehts, sagen wir mal, unentschieden?

  • Stefan W. sagt:

    Erkenntnis und Bekenntnis schliessen einander überhaupt nicht aus. Wer seinen Kindern weis macht, die Evolution erkläre die Entstehung des Lebens oder die Astrophysik erkläre die Entstehung des Universums, der lügt sie genauso an wie jemand, der behauptet, der liebe Gott habe vom 4. bis 10. Januar 5437 v. Chr. alles erschaffen.

    Das einzige was wir zur Entstehung des Kosmos wissen ist, dass wir nicht wissen, wieso eine Singularität existieren und dann plötzlich zu einem Universum expandieren sollte. Wir wissen nichtmal, was eine solche Singularität eigentlich ist, ausser dass sie die Eigenschaft hatte, aus ungeklärten Gründen zu einem Universum mitsamt Zeit, Raum, Energie und allen physikalischen Gesetzen geworden zu sein. Vergleichbare Unsicherheit gilt auch für andere kosmologische Theorien, die auf Singularität und Urknall verzichten.

    Und das einzige, was wir zur Entstehung des Lebens wissen ist, dass wir nicht wissen, wie und warum es entstanden ist. Die Evolution erklärt nämlich nur, wie sich Leben weiterentwickelt. Keineswegs, wie es entsteht. Miller und Urey haben in den 50er Jahren in einer künstlichen Umgebung, die der Umgebung der Ur-Erde nicht so sehr glich, wie sie damals glaubten, ein paar organische Moleküle hergestellt. Dies ist noch heute das einzige, was zum Thema „spontanes Entstehen von Leben“ vorgebracht wird. Mit anderen Worten: Nach wie vor weiss niemand, wie das Leben auf der Erde entstanden ist, und für Leben auf anderen Welten gibt es nicht den Hauch eines Beweises, sondern nur den Glauben daran.

    Wieso man da unbedingt einen künstlichen Graben zwischen den erforschbaren und den unerforschbaren Bereichen unserer Existenz ziehen will, ist mit schleierhaft. Sie gehören beide schlicht zur Realität.

    • mira sagt:

      „Wieso man da unbedingt einen künstlichen Graben zwischen den erforschbaren und den unerforschbaren Bereichen unserer Existenz ziehen will, ist mit schleierhaft. Sie gehören beide schlicht zur Realität.“

      Sehr schön ausgedrückt.

    • Benjamin Hitz sagt:

      Das ist doch mal ein guter Beitrag zur Diskussion. Die meisten Leute kennen ja nur die Absolutheit von entweder Kreationist oder Super-(und pseudo-)Rational.

    • Roman Günter sagt:

      Das mit dem künstlichen Graben tönt vielleicht schön, ist aber der Unterschied zwischen; „es ist so – Punkt!“ und „so könnte es gewesen sein, schauen wir mal, vielleicht finden wir noch mehr heraus“. Ein wahrlich fundamentaler Unterschied, wie mir scheint.

      • Stefan W. sagt:

        @Roman Günter: Ein fundamentaler Unterschied besteht zweifellos zwischen einem religiösen Fundamentalisten und einem Skeptiker oder Agnostiker. Der Unterschied ist schon nicht mehr so gross zu einem militanten Atheisten.

        Am wichtigsten ist aber: Nicht jeder, der glaubt, dass es etwas ausserhalb der Naturwissenschaft geben könnte, ist ein religiöser Fundamentalist. Schliesslich hat die Naturwissenschaft ja anerkanntermassen erst mit oder einige Mikrosekunden nach dem Urknall angefangen. Vorher gab es mangels Zeit kein Vorher und kein Nachher und damit auch keine Ursache/Wirkungsbeziehungen und darum keine Naturwissenschaft. Ok, man kann sich mehr oder weniger elegant aus der Affäre ziehen, indem man behauptet, dann sei eben „nichts“ gewesen. Aber Sie werden zugeben, dass dieses „nichts“ auch nicht wirklich besser rational erfassbar ist, als die Alternative „Etwas Unbekanntes“.

    • Blitz Blank sagt:

      🙂

      „Es ist derjenige am weitesten von der Wahrheit entfernt, der auf alles eine Antwort hat.“
      Zhuang Zhou

      • Auguste sagt:

        hmm…, hätte es das kreuzworträtsel damals schon gegeben, er hätte sich ein anderes sprüchli ausdenken müssen.

    • Orlando S. sagt:

      Klarheit im Denken – ein erfrischender Text, fürwahr!

      • Der Unterschied ist, dass die Wissenschaft überprüfbare Thesen aufstellt. Erkenntnis hat also immer etwas mit methodischer Nachvollziehbarkeit zu tun – Bekenntnis nicht.

        Selbstredend produziert die Wissenschaft mit gutem Grund Hypothesen zur Entstehung des Lebens. Diese lassen sich überprüfen, z.B. indem man im Labor Bedingungen herstellt, unter denen gemäss einer solchen Hypothese z.B. spontane Aminosäurenbildungen entstehen sollten. Der aktuelle Stand der Forschung reicht aber in der Tat nicht aus, um die Anfänge des Lebens auf der Erde zu erklären – wohl aber, wie nach diesen Anfängen sich das Leben weiter entwickelt hat. Die Forschung geht weiter und unser Verständnis wird weiter zunehmen.

        Wissenschaft bedingt Geduld und Skeptizismus, Bekenntnis nicht. Bekenntnis heisst letztlich, eine tradierte Behauptung zu verinnerlichen.

      • the man sagt:

        @ Andreas Kyriacou
        Dann anerkennen Sie aber bitte, dass es auch einen theologischen Diskurs gibt, der ebenso vom Skeptizismus lebt. Grossartige Denker haben sich eben nicht mit den Dogmen abgefunden, und die Theologie damit weiterentwickelt. Sie setzt sich heute sowohl mit der Tradition als auch mit dem neusten Stand der Wissenschaft auseinander.

      • fufi sagt:

        @Andreas K.
        Können Sie bitte zunächst erklären, WAS Sie genau unter „Wissenschaft“ verstehen möchten? Gehören daz auch, beispielsweise, vergleichende Linguistik, frühmittelalterliche Geschichte, Verhaltensökonomie und kognitive Psychologie? und vielleicht am Ende sogar auch Theologie? Nja: Immerhin werden ALLE diese Disziplinen an UNIVERSITAETEN gelehrt!
        🙁
        Oder halten Sie es – mit so einem ziemlich eingeschränkten Blickfeld – etwa nur mit den sogenannten „Natur“-Wissenschaften? (Welche auch immer Sie denn als solchige gelten lassen mögen)
        Aber auch dann müsste ich Sie leider etwas korrigieren:
        KLAR stellen NW Thesen/Hypothesen auf, zum Beispiel:
        1. Die Quantentheorie – die Relativitätstheorie – die Urknall- oder auch die Steady-state-Theorie, etc. Allen gemeinsam ist, dass all dieses „WISSEN“ daraus resultiert, dass gewisse mathematische Formeln aufgestellt werden und danach gewisse Anzeigen von Messapparaten derart interpretiert werden können, dass die Ergebnisse der Interpratationen so in die mathematischen Formeln eingefügt werden können, dass sich daraus kein interner Widerspruch ergibt.
        2. Habe echt noch KEINEN mathematisch stichhaltigen Beweis für die Evolutionstheorie gelesen. Und möchte Sie gerne fragen, inwieweit deren Thesen denn überprüfbar sein sollten!
        3. Zur DNA – WOW! Sobald das menschliche Genom entziffert ist, wissen wir alles über uns. Soso?
        Und WAS wissen wir WIRKLICH über die DNA? Lernen wir etwas, wenn wir auf computergenerierte Auswertungen schauen, auf denen , z,B.:
        AAATTGCTTGAATTTGAAATGCCTGAATGTGTGCTGTGCC
        erscheint?
        (für NICHT-Genetikerinnen: das könnte ein Abschnitt der DNA sein, in der Sprache der Moleküle)
        Und wurde alles, was darüber zu Wissen „geglaubt“ wurde, nicht unlängst von der „Epigenetik“ ins wissenschaftliche Abwassersystem gespült, sozusagen?
        😀

        Neinein, Herr K. Sie machen es sich da etwas ZU einfach!
        Glauben heisst zunächst Glauben. Und das muss NICHT zwingend ein religiöser Glaube sein.
        Fortschritt? – mögen Sie sich an die Visionen von atombetriebenen Flugis erinnern? – oder an dieses oder jenes?
        Wohlstand? – Jedem Schweizer – Schweizerinnen gab’s damals noch nicht – sein Häuschen im Grünen?
        Nationale Werte? – Die Knarre im Haus erspart den Scheidungsrichter?

      • fufi sagt:

        Mister A.K.: wo sind sie denn?

      • fufi sagt:

        Mister A.K.: wo sind sie denn?
        Müssen sich nicht verstecken!
        😉

  • Leo Stern sagt:

    Liebe Michèle, ihr Kleiner hat es erlickt: Mama macht den PC parat, die Schwester geht die DVD suchen und was macht er? Die Lektion hat er gelernt: Bete, arbeiten sollen die anderen.

  • Barbara sagt:

    ein wunderschöner Widerspruch: nicht an Gott glauben aber Weihnachten feiern – die Geschenke bitte nicht vergessen…

    • Blitz Blank sagt:

      Glauben Sie wirklich, dass Christus an Weihnachten auf die Welt gekommen ist? Lichtfeiern um den kürzesten Tag hat es schon immer gegeben. Meines Wissens war das Weihnachtsdatum ein römischer Festtag, der dann von der Christlichen Religion gekapert wurde (wie auch viele alte Kultstätten zerstört und dann darauf Kirchen gebaut wurden).

      • mira sagt:

        Auch das Konzept Gott wurde nicht vom Christentum erfunden, sondern ist viel älter…. Ist es jetzt daher besser? Oder glaubwürdiger? Komische Argumentationsweise haben Sie…

    • Logine sagt:

      Weihnachten, bzw. die Wintersonnenwende feierten wir hierzulande lange bevor von Christen auch nur der Schatten zu sehen war. Das Christentum bediente sich mancher solcher heidnischer Bräuche und deutete sie munter um, denn die Menschen lassen sich ihre Feste ja nur ungern wegnehmen….Egal, was der Grund dafür….. Wer feiert denn am 1. Mai noch die Arbeiterkämpfe? Wenn sie frei haben und eine Brücke winkt fährt auch der Kapitalist in den Süden….Und genauso steht’s doch mit den vielen Taufchristen, hier und anderswo.

      • Brunhild Steiner sagt:

        @Blitz Blank
        @Logine:
        als das Christentum Staatsreligion wurde, und somit auch die kirchlichen Feiertage fest in eine Agenda geschrieben wurden, da hat man aus praktischen/taktischen Überlegungen den Gedenktag von Christi Geburt in eine Zeit gelegt wo sich die Menschen schon ans Feiern gewohnt waren.
        Ostern allerdings hat sich immer am jüdischen Passahfest orientiert und Auffahrt/Pfingsten folgen nach einer bestimmten Anzahl Tage danach.
        Das Christentum hat überhaupt nichts „munter umgedeutet“.
        Was Sie der Institution zu Recht vorwerfen könnten, ist das zu grosszügige Anpassen an schon bestehende Festdaten. Und das für „christlich erklären“ von Symbolen, welche auch einen anderen Erklärungshintergrund haben können- bloss dass eben der Baum und die Lichter sehr wohl auch symbolischen Boden in der Person von JC finden.

      • Blitz Blank sagt:

        Die Geschichte des Weihnachtsbaumes gibt es auch auch Wikipedia:

        http://de.wikipedia.org/wiki/Weihnachtsbaum#Geschichte

      • Auguste sagt:

        hmm…, „denn die menschen lassen sich ihre feste ja nur ungern wegnehmen…“ – haben sie das laute „jawohll!“ von elmar ledergerber auch vernommen, logine.

  • Robert sagt:

    Um auf das Thema zurückzukommen:

    Unser Kind damals in den R+K-Unterricht geschickt zu haben war verbunden mit Gefühlen wie nicht genau zu wissen, ob der Turnlehrer raucht.

    Lehrer, so hat man bald mal herausgefunden, sind manchmal nichts anderes als ziemlich komische Typen. In Mathematik oder Französisch oder Biologie war das aber nie so bedeutungsvoll wie in R+K. Wenn das Kind nach Hause kommt und falsch rechnet ist das etwas anderes als wenn es plötzlich verlangt, dass die Familie am Sonntag in die Kirche gehen müsse – und man nicht mal genau weiss, wie es soweit kommen konnte.

    Während ich es bei z.B. sexueller Aufklärung dienlich finde, wenn das jemand Aussenstehender macht, so finde ich es bei R+K dienlich, wenn sich das in unserer Familie abspielt.

    • Benjamin Hitz sagt:

      Ja, das wäre ja allerhand, wenn der Turnlehrer rauchen würde! Und Lehrer sind natürlich komische Typen, denen man zwar die Sexualaufklärung delegieren kann, weil man das selber irgendwie unangenehm findet, aber sonst sollen sie sich doch bitte nach den Wünschen der Eltern richten (und zwar aller Eltern individuell…Schule ist schliesslich ein Wunschkonzert).

  • Logine sagt:

    J-R: woher nehmen Sie ihr Geheimwissen über Freidenker?

    Mira: Es ist wohl wahr, die einen brauchen den Osterhasen, manche wohl auch nur schon deshalb, damit das Jahr Struktur hat oder sie eine Ausrede, das feine Süss zu naschen 🙂

    Das wusste B.Brecht genau, als er seinen Herrn Keuner folgende Begebenheit berichten liess:

    Einer fragte Herrn K., ob es einen Gott gäbe.

    Herr K. sagte: „Ich rate dir, nachzudenken, ob dein Verhalten je nach der Antwort auf diese Frage sich ändern würde.
    Würde es sich nicht ändern, dann können wir die Frage fallen lassen.

    Würde es sich ändern, dann kann ich dir wenigstens noch so weit behilflich sein, dass ich dir sage, du hast dich schon entschieden:

    Du brauchst einen Gott.“

    Es wäre schon ein schönes Zeichen der Bescheidenheit, wenn man seine eigenen Bedürfnisse als solche deklariert und nicht der gesamten Spezies Mensch andichten würde. Selbst in Ländern wie dem Iran, in denen die Todesstrafe auf den Abfall vom Glauben steht gibt es Atheisten.
    Und ganz besonders interessant dünkt mich die Erfahrung des Linguisten Daniel Evett, der auszog, einem Volk Gott zu bringen und sich vom „glücklichsten Volk“ zum Unglauben bekehren liess: http://www.taz.de/1/archiv/digitaz/artikel/?ressort=pb&dig=2010%2F08%2F28%2Fa0033&cHash=e5b9ffdec0

  • besserwisser sagt:

    es ist doch klar das kinder für religionen sensibilisiert werden müssen. nicht um ihnen zu zeigen wie diese denke bzw glauben sondern um zu sagen es gibt sie. kinder müssen lernen später damit umgehen zu können.
    im Allgemein unterricht, so ein Fach gibt es noch nicht an allen Schulen, sollte religion durchaus mal behandelt werden nicht mehr!

  • Michaela Stalder sagt:

    Ein Sechsjähriger der an den Urknall glaubt und dank Harry Potter elektrisch aufgeladen ist, wird doch wohl im Schulfach „Religion und Kultur“ differenziert unterscheiden können, was ihn religiös infiltriert oder kulturell informiert…

    Leider ist es doch meist so, das jeder Mensch das glaubt, was ihm lange genug um die Ohren geschlagen wird… völlig egal ob Religion oder Werbung oder sonstwas. Bevor man Kindern also den Urknall oder Harry Potter oder religiösen Firlefanz auftischt, versuche man vielleicht ihnen beizubringen, an die eigenen Fähigkeiten zu glauben. Es könnte durchaus hilfreich sein.

  • S. Ryter sagt:

    Ach, herrlich! Es gibt diese Themen, bei denen kommen sofort sämtliche Foren-Trolle der Galaxis mit Geifer im Mundwinkel aus ihren Löchern gesprungen und greifen in die Tasten. Irgendwas zum Geschlechter-Verhältnis z.B., das geht immer. Oder eben Religion. Da kann auch jede/r was zu sagen, und zwar je weniger Ahnung, desto mehr.

    Kirche = Macht und Geld? Religionsunterricht = Indoktrination? Leute, auf welchem 19.-Jhd.-Dampfer lebt ihr denn eigentlich? Wenn es um Macht und Geld und/oder Indoktrination geht, fallen mir eine ganze Reihe anderer Protagonisten ein, bevor ich an die schlümme, schlümme Kirche denke.

    Im Übrigen – oben ist es schon angeklungen – haben ja bereits einige Gesellschaften und Staaten versucht, das Religiöse auszurotten oder wenigstens an den Rand zu drängen und aus dem öffentlichen Leben zu verbannen. Ergebnis: weder ist das Abschaffen der Religiosität gelungen noch waren diese Gesellschaften besser, gerechter oder fortschrittlicher als andere.

    Fazit: Einfach ein paar Etagen tiefer hängen, das Thema. Kinder werden nicht zu besseren oder schlechteren Menschen, wenn sie in der Schule (keinen) Religionsunterricht haben. Und sie werden vermutlich auch nicht traumatisiert oder zu Psychowracks. (Da scheinen mir andere Einflüsse weit prägender zu sein.)

    • Fernando sagt:

      Sie sprechen mir aus der Seele!! Aber eine Frage ist doch schon: Warum ist es denn eigentlich so schwierig, das Thema „einfach“ ein paar Etagen tiefer zu hängen? Wie wenn in geistigen Dingen „Nüchternheit“ gerade nicht unser Grundzustand wäre…

      • rosi sagt:

        S. Ryter – ich möchte mich Ihnen anschliessen. Eiferer und Rechthaber auf beiden Seiten… Ich glaube auch, dass es Schlimmeres auf der Welt gibt, als Religionsunterricht in der Schule.

      • Papi sagt:

        „Warum ist es denn eigentlich so schwierig, das Thema “einfach” ein paar Etagen tiefer zu hängen? “

        Weil das Thema an das Fundament der Menschlichen Existenz führt. Und wer sieht schon gerne dass sein eigenes Fundament zerfällt?

      • Rocket sagt:

        @ Fernando, weil Eure Fraktion über Jahrhunderte, als Ihr euch mit der weltlichen Macht verbündet habt, blutig und grausam unter denjenigen gewütet habt, die eure Dogmas anzweifelten. Wehret den Anfängen.

    • Blitz Blank sagt:

      Bravo!

      Ich denke auch, dass Kinder viel autonomer sind und nicht gleich von jedem „Haferschiss“ indoktriniert werden. Gehirnwäsche braucht einiges an Aufwand, wie man bei allen religiösen Ultras schön sehen kann.
      Solange man Kinder mit der Vielgestaltigkeit der Welt und des Lebens in Berührung kommen lässt werden Kinder ihre eigenen Schlüsse ziehen und ihren Weg selber bestimmen.

    • bei den Basteleien des Kantons Zürich zum Fach Religion und Kultur sind nicht die Kirchenvertreter das Problem, sondern ein orthodox tickender Bildungsratsvertreter und Verantwortliche der Bildungsdirektion, die nicht sehen wollen, dass voll Kurs auf den Eisberg genommen wird. Nicht der Titel ist das Problem bei diesem Fach sondern die Ausgrenzung jeglicher weltlicher Ethik und die stereotype Darstellung der Reilgionen. Es braucht einen Neuanfang unter neuer Leitung. Sonst versenkt sinnloserweise der Kanton mehr Geld als mit dem PJZ.

  • J_Randi sagt:

    Beten oder Homöopathie. Ist beides gleich wirksam. Viele Leute brauchen ein Glaubenssystem, und wer nicht an Gott glauben mag (und sich Freidenker brüstet), glaubt häufig so Quatsch wie Astrologie oder Homöopathie.

  • mira sagt:

    Der Mensch braucht eine Religion. Glauben wollen ist ein wesentlicher Bestandteil seines Wesens und ich wage zu behaupten, dass eine Kultur nur begrenzt Bestand hat, wenn sie jegliche Religion von sich streift. Eine solche Kultur lässt die Menschen halt- und bezuglos. Das Christentum ist eine von vielen Religionen, welche den Menschen Halt und Geborgenheit gibt. Nicht nur im Alltag, sondern vorallem in schwierigen Tagen. Wären wir zu einer anderen Zeit oder in einem anderen Land geboren, dann wäre das der Islam, der Hinduismus oder eine Naturreligion. Letztendlich spielt es wohl gar nicht so eine grosse Rolle, welche Religion es ist.

    Die Zeit schreitet voran und wir wissen immer mehr. Das Wissen um die Entstehung des Donners hat den Donnergott unnötig gemacht. Das voranschreitende Wissen um den Urknall und Evolution stellt die Schöpfungsgeschichte in Frage (wenn man sie absolutistisch statt symbolisch betrachtet). So wird die Religion der Zukunft nicht das traditionelle Christentum sein, sondern etwas Neues. Etwas, welches aus der Symbiose von althergebrachtem Glauben und neuem Wissen besteht. Kein Physiker oder Biologe dieser Welt hat die „Weltformel“, das grosse Unbekannte steckt noch immer in allem und wir sind ein Teil dessen. Und daher ist auch heute noch Religion so aktuell wie immer.

    Aufgrund dieser Überlegungen fände ich es fatal, dieses Fach abzuschaffen. Religion gehört zu uns. Was keinen Platz haben sollte, ist aber der Fundamentalismus. Ein strikter Atheismus ist bester Nährboden für diesen, da zuviele Menschen einen Glauben brauchen und suchen. Gibt man ihnen keine moderate Nahrung suchen sie sich das Extreme.

    • Mike sagt:

      Der Mensch braucht eine Religion? Dann bin ich also kein Mensch? So ein Blödsinn hab ich ja schon lange nicht mehr gehört!!!

      • mira sagt:

        Ich schreibe hier vom Menschen als Rasse und nicht von einem Individuum. Ich glaube Ihnen sehr gerne, dass sie keine Religion brauchen. Ich habe auch lange Zeit ohne Religion gelebt und war nicht unglücklich mit der Situation. Ebenso kenne ich Menschen die ohne Religion aufgewachsen sind und immer noch ohne Relgion sind und auch damit zufrieden sind.

    • Martin CH sagt:

      Da hast du absolut recht mira. die Religion gehört zum Menschen. Denn jeder Mensch hat eine Religion auch diejenigen die behaupten sie hätten keine.
      Religion kommta aus dem lateinischen religare, und heisst soviel wie „zurückbinden“
      Jeder Mensch „bindet sich auf etwas zurück“ kein Mensch kann alleine überleben.
      die Götter die heute verehrt werden sind meistens das Geld und die Beziehung natürlich gibt es noch viele andere.
      Doch diese Götter sind endlich und haben keinen wirklichen bestand sie können zerfallen und tun dies auch immer wieder.

      was bedeutet glauben?
      im althochdeutschen galaubian = lieb haben
      im hebräischen Aman = fest stehen, gegründet sein
      im griechischen pistoiein = vertrauen.
      im latein credo / cordare = sein Herz geben, sein Herz an etwas hängen

      glaube bedeutet also an was hängt unser Herz und Religion beschäftig sich mit der Frage worauf können wir ganz sicher vertrauen woran können wir sicher uns Herz hängen, ohne das es verletzt wird.

      Wenn wir die Welt anschauen, wie wir sie erleben und wie sie ist. Dann müssen wir sagen es gibt IN dieser Welt nichts auf das wir uns hundertprozentig verlassen können.

      Ich weiss nicht, ob es einen Gott gibt.
      Doch ich lese die Evangelien und sehe wie Jesus gelebt hat und ich sehe wie viele Menschen Heilige durch die Jahunderte gelebt haben. Ich sehe das sie aus einer unglaublich grossen Kraft heraus gelebt haben sie zeigen mir das es ein Kraft gibt die grösser ist als wir Menschen.

      Der Gott des Christentums ist die Quelle der Liebe. diese Quelle ist nicht IN dieser Welt.
      Die Liebe ist in der Welt aber nicht von der Welt.
      Gott ist nicht von dieser Welt, darum können wir ihn auch nicht beweisen. Er/sie hat ihren Ursprung nicht hier. Doch Sie durchdringt diese ganze Welt.

      Doch Jesus Christus kann ich an Gott „Vater“ glauben, denn er hat die Quelle bezeugt/gelebt/gezeigt.
      Durch den Heiligen Geist in uns sind wir mit Gott verbunden. Wir heissen nicht nur Kinder Gottes, wir sind es auch.

      Leben wir also die Liebe Gottes die uns uns ist, erkennen wir das wir Anteil haben ein einem grösseren Ganzen auf das wir wirklich vertrauen können.

      • mira sagt:

        Ich bin auch immer wieder beeindruckt, ob der Kraft, welche stark religiöse Menschen ausstrahlen und ob der Werke, welche sie imstande sind, zu vollbringen (z.B. Mutter Theresa, Frère Roger, Thich Nhat Hanh).

        „Der Gott des Christentums ist die Quelle der Liebe. diese Quelle ist nicht IN dieser Welt.“

        Ich sage: Gott ist überall, in uns, um uns, mit uns. Jeder von uns ist ein Teil von Ihm. Aber es liegt an uns, die (göttlichen) Qualitäten in uns zu aktivieren und z.B. Nächstenliebe zu leben. Ich glaube sehr wohl, dass die Quelle IN dieser Welt liegt.

      • Katharina sagt:

        Nun mira, ich sehe es so:

        wir sind teil eines Multiversums und was wir als Realität wahrnehmen, ist eine Projektion auf vier Dimensionen dieses Multidimensionalen.
        (Vier Dimensionen: 3 räumliche und die vierte – Zeit wird von uns als sequentieller Ablauf wahrgenommen. Wahrgenommen ist das wichtige Wort).

        die physischen Abläufe darin sind alles Effekte quantenmechanischer Fluktuationen. diese sind dynamisches Resultat statistischer Wahrscheinlichkeiten. (das ist wirklich so).

        es ist experimentell nachgewiesen worden, dass gedankliche Vorgänge die Wahrscheinlichkeit beeinflussen.

        es kann also daraus extrapoliert werden, dass das kartesische Produkt der gedanklichen Vorgänge aller sentienten Wesen das Resultat quantenmechanischer Fluktuationen determiniert.

        Somit stimme ich ihnen zu – mit dem Zusatz, dass die quelle nicht IN dieser Welt ist, da diese nur eine vierdimensionale Projektion von etwas komplexeren ist, und unsere Gedanken die Fähigkeit haben, zurück zu projizieren.

        ein teil des ganzen und das ganze ist nicht eine Addition, sondern ein kartesisches Produkt.

      • mira sagt:

        @Katharina
        Ich verstehe „diese Welt“ nicht nur aus 4 Dimensionen, sondern als Gesamtheit von fassbaren (oder von uns messbaren) und unfassbaren Dingen. Der von Ihnen geschilderte Ansatz ist interessant und weist gleichzeitig auf ältere mystische Konzepte hin.

        „es kann also daraus extrapoliert werden, dass das kartesische Produkt der gedanklichen Vorgänge aller sentienten Wesen das Resultat quantenmechanischer Fluktuationen determiniert.“

        Das würde bedeuten, dass Beten für etwas Gutes durchaus sinnvoll sein kann. Vorallem, wenn es von grossen Massen gemacht wird.

    • marcus sagt:

      der mensch braucht spiritualität, aber keine religion.

      • mira sagt:

        Nein, die Masse braucht Religion, denn sie braucht klare Regeln. Sie will folgen. Oder auch Nicht-folgen. Oder am Folgen hadern. Das Suchen von neuen Wegen (Spiritualität) ist anspruchsvoll und nicht jedem in die Wiege gelegt…

  • F. Schlumpf sagt:

    Gründen letztlich nicht auch humanistisch-ethische Werte auf einem aufgeklärten Glauben? Genau das Gegenteil ist der Fall Humanismus und Ethik hat sich gegen den Glauben entwickelt. Für mich hat Religion nur etwas Gutes gehabt: Dadurch, dass fast 2000 Jahre lang religiöse Menschen haupsächlich geschlachtet, unterdrückt, gesäubert und vergewaltigt haben und damit sich gleich wie Könige und Diktatoren verhielten, hat dies sicher dazu beigetragen, dass sich die Aufklärung überhaupt durchsetzen konnte. Hätte irgend eine Religion etwas Moralisches ansich, wäre es ja nie zur Aufklärung gekommen sondern wir hätten von Königen und Diktatoren zu Papst und Iman gewechselt.

  • Pippi Langstrumpf sagt:

    Grundsätzlich: jeder Mensch glaubt, was er kann.

    Die Schule sollte die verschiedenen Religionen von einem nicht religiösen Standpunkt aus vorstellen, aber erst in den höheren Klassen, vorher sind die Kinder nicht fähig, das wirklich zu begreifen.

    Religionen, die – und das ist das Entscheidende – demokratiekompatibel sind, sollten gleichberechtigt behandelt werden. Dass hier im Westen das Christentum einen entscheidenden Einfluss auf unsere Kultur hatte und noch hat, finde ich nicht problematisch, es gehört zu uns, auch wenn ich selbst nicht gläubig bin. Es sollte deshalb kein Problem sein, in der Schule Weihnachten miteinander zu feiern. Eltern, die das nicht wollen, können ihre Kinder dispensieren lassen.

    Ich habe jedes Jahr einen Weihnachtsbaum, er gehört für mich dazu, weil die Botschaft der Liebe, die JC verbreitete, auch für mich als längst Ausgetretene etwas Positives ist.

    Das Feiern um die Weihnachtszeit ist übrigens viel älter als Weihachten, auch den Tannenbaum als Zeichen, dass die Natur nur schläft und die Fruchtbarkeit wiederkommt, kannte man schon in früheren Kulturen.

    • Rocket sagt:

      Der Weihnachtsbaum hat mit Jesus Christus etwa soviel zu tun wie die Lampions mit dem 1. August. Die Feier hat nichts mit den (aus kommerziellen oder kulturellen Gründen hinzugekommenen) Accessoires zu tun. Ihnen gefällt der grüne Baum weil er mit seinen farbigen Kugeln einen schönen Kontrast zur weissgrauen Winterwelt bietet. JC’s Botschaft gefällt Ihnen, wie Ihnen Krishnas Botschaft, oder die von Epikur (Begründer einer areligiösen Ethik) gefallen würde.

    • Globetrotterin sagt:

      Nein, Pippi! Da bin ich nicht einverstanden. Schau Dir mal genau all die Religionen an, mit einem männlichen Schöpfergott an der Spitze. Sie alle wurden ausnahmslos von Männern gegründet und erfunden, in erster Linie um ihre Vorherrschaft den Frauen gegenüber zu implementieren. Auch heute noch sind es Männer, die an diesen Religionen festhalten und sie unter keinen Umständen preisgeben wollen. In all diesen Religionen haben Frauen nichts zu sagen. Eine Frau, die einer solchen Religion beitritt, ist in Etwa das Gleiche, wie ein Schwarzer, der dem Ku-Klux-Clan beitritt!

  • Nils Holgerson sagt:

    Warum ist es Gott/Alah/sonstwer so wichtig das wir an ihn glauben? Was hat er überhaupt davon?
    Interessiert es Gott/Alah/sonstwer es überhaupt was wir tun, wie wir uns fühlen, wie es uns geht?
    Nein, er zeigt kein interesse an den Menschen, wir sind ihm scheissegeal, was er uns auch tagtäglich
    mit seiner Güte beweisst . Naturkatastrophen, Krankheiten und alle anderen Nettigkeiten treffen Christen/Muslime/Juden
    gleichermasen trotz ihres Gottes. Ethik und Morlal sind mit sicherheit keine Kernkompetenz der Religionen.
    Geht weiter in die Kirchen und zahlt eure Kirchensteuern schön brav.

    • the man sagt:

      Und was tun Sie gegen das Leid dieser Welt? Mutige Blogeinträge schreiben?!?

    • Leo sagt:

      Ich hätte gerne mal ein wirklich fundiertes Argument, warum ich sozial denkend, den Mitmenschen immer helfend, sie liebend leben soll, wenn ich wegen dem Glauben (für mich ist es fast Wissen), dass ich mal wirklich gerecht gerichtet werde. Einigermassen sozial, auf einem sehr tiefen Niveau muss ich mich als Ungläubiger doch nur bewegen, um selber in einer angenehmen sozialen Umgebung zu leben. Darüber hinaus, Opfer von Tsunamis, Erdbeeben etc. irgendwo auf der Welt? Denen zu helfen mindert doch nur meine Möglichkeiten für ein bequemes Leben in meiner Umgebung. EInfach so als Beispiel.
      Ich glaube an Gott, den gerechten Richter, durch dessen Willen das All, die Welt, das Leben entstand, sich dauern weiter eintwickelt bis es dann eines Tages gemäss seinen Vorstellungen perfekt und vollkommen da stehen wird. Halt dann ohne den Menschen, der immer weniger an der positiven, desto mehr an der zerstörerischen Weiterentwicklkung der Erde teilnimmt. Aber es gibt und gab ja noch Milliarden von weiteren „Sternen“. Sagen wir denen mal so.

      • Wer nur deshalb Nächstenliebe zeigt, weil er Angst vor dem Höllenfeuer hat, handelt zutiefst egoistisch. Der Effekt mag durchaus ein positiver sein, doch die Motivation ist doch sowas von unchristlich!

        Wer hingegen begriffen hat, was Humanismus ist, handelt nicht aus Angst oder um Karmapunkte zu sammeln menschlich.

  • In der Schweiz wurde vor geraumer Zeit beschlossen, Staat und Kirche zu trennen. Gott aus den Klassenzimmern zu verbannen, wäre also streng genommen rechtens. Nur ist die Trennung von Staat und Kirche kein Verbot. Wenn jetzt also irgendjemand aus dem politischen Betrieb aufgrund einer plötzlichen Eingebung- womöglich einer atheistischen- entscheidet, Gott konsequent aus sämtlichen Klassenzimmern zu verbannen, dann wird sein Unglaube zur neuen Norm. Und dagegen möchte ich mich in aller Entschiedenheit verwahren!

    • A. Schneitter sagt:

      Das ist nicht korrekt. Die Frage des Verhältnisses zwischen Staat und Religion wird in der Schweiz kantonal geregelt, wobei es grosse Unterschiede gibt. Von einer vollständigen Säkularität, wie sie in den USA praktiziert wird, oder gar einem Laizismus nach französischem Vorbild, ist die Schweiz aber weit entfernt. Das Modell der öffentlich-rechtlichen Anerkennung, das abgesehen von GE und NE alle Kantone praktizieren, ist keine Trennung von Kirche und Staat, sondern bindet verschiedene Konfessionen (und z.T. Religionen) als öffentliche Rechtsträger in den Staat ein.

    • Andi Koch sagt:

      Deswegen ist der Begriff „Atheismus“ auch nicht zutreffend bzw. ohne Inhalt.

      Das Konzept Gott ist nicht bewiesen. Es gibt keine Evidenz für Gott. Und Gott ist auch nie so definiert, dass man es/ihn/sie experimentell nachweisen kann. Komisch, dass Menschen in unserer Zeit in dieser Kultur täglich dutzende wenn nicht hunderte Male wissenschaftlich denken und vorgehen, und dies bei trivilalen Fragen, dann aber den Verstand aussetzen, wenn es um die Frage geht, ob wir unser ganzes Leben von der Zeugung bis zum Sterben selbstverantwortlich ohne mögliche Lenkung von oben/aussen oder aber abdelegiert an „eine Macht“ führen sollen.

      Im Gegensatz zur Homöopathie und Astrologie, beides Disziplinen, die man zu Recht belächeln darf, weil sie einer kritischen Ueberprüfung nicht stand halten, geht es den Religionen doch geradezu gut. Dies wahrscheinlich deshalb, weil sie sich bisher präziser Aussagen/Prognosen enthielten (Jesus wird wieder kommen im Gegensatz zu Jesus wird im Jahr 2011 wieder kommen) und damit nicht durch jedermann, der den göttlichen Stellvertretern auf Erden Glauben und Geld schenken soll, zu überprüfen sind. Religionen stellen keine Hypothesen, die man verifizieren oder falsifizieren kann auf. Das macht religiösen Glauben zu wischiwaschi.

      Gott aus dem Klassenzimmer verbannen heisst nicht, dass man Gott nicht zum Thema machen kann. Nur ist das Thema dann zu öffnen. Es geht dann nicht mehr nur um 5 Religionen. Aber gerade diese Oeffnung birgt Sprengstoff in sich, den Religiöse fürchten. Oeffnen heisst Fragen stellen. Fragen, die eben Adam und Eva schon nicht hätten stellen sollen…. Und am Ende dieser Oeffnung steht dann eben die Einsicht, dass es Gott wahrscheinlich nicht gibt, denn alles um uns herum kann auf natürliche Weise erklärt werden, auch wenn bei vielen Fragen die Details und das Wissen noch fehlen. Und natürlich kann man eine Existenz eines Gottes, einer Göttin, von Göttern nicht widerlegen (geht logischerweise gar nicht, es sei denn, man wird sachlich und differenzierter in der Definition des Begriffes wie nur von „eine höhere Macht“ zu sprechen). Und so könnten dann eben zuviele Kinder zum Schluss kommen: na, wenn man diesen Gott nicht sehen, hören, fühlen, messen und mit ihm interagieren kann und er/sie/es sich scheinbar nicht um uns Menschen kümmert, ja dann gibt es ihn evtl. gar nicht bzw. wenn es ihn gibt, ist er ein schlechter Kommunikator, ist er für mein Leben irrelevant.

      • the man sagt:

        Sie haben ein ziemlich eingeschränktes Bild vom Glauben. Die moderne Theologie ist weit weg von einfachen Dogmen und sieht durchaus ein „selbstverantwortliches“ Leben der Menschen vor. Natürlich macht keine differenzierte Religion einfach Aussagen über die Zukunft – das wäre plumpe Effekthascherei. Ihre These, dass alles um uns herum irgendeinmal erklärt werden könne, wenn man nur das nötige Wissen habe, ist übrigens auch nur ein Glaubensgrundsatz.

        Es mag sein dass bei der Auseinandersetzung mit dem Thema „Gott“ der eine oder andere (vielleicht sogar eine Mehrheit, wer weiss?) zum Schluss kommen wird, dass es keine höhere Macht gibt. Wie mit dieser Erkenntniss dann umgegangen wird dürfte ein anderes Problem sein. Vielleicht ist das aber auch nur in unserem behüteten Umfeld so. Wie sieht es wohl in anderen Teilen dieser Welt aus? Können Sie verstehen, dass es für millionen von Menschen, deren Leben zu einem grossen Teil aus Leiden besteht tröstlich sein kann wenn sie die Gewissheit haben, dass sich diese Mühe in einem anderen Leben auszahlt? All diesen Menschen spenden Religionen Hoffnung – das kann kein Freidenker!

      • Wenn „Gott“ so ein schlechter Kommunikator ist, Andi Koch. Warum dann bestand die Alte Eidgenossenschaft „Im Namen Gottes des Allmächtigen“ von 1291 bis 1798 und wurde 1815 schon wieder „Im Namen Gottes des Allmächtigen“ gegründet? Warum waren es die Aargauer LIberalen die 1832, auf dem Höhepunkt der Auseinandersetzung zwischen Liberalen und Konservativen (es gab auch Tote damals, aber davon steht wenig in unseren „liberalen“ Geschichtsbüchern) einen „Eidgenössischen Dank-,Buss- und Bettag“ einführten, der in einer Abstimmung 2005 im Kanton Solothurn immer noch 70% Zustimmung im Stimmvolk fand. Warum wurde der liberale, säkulare Bundesstaat 1848 und 1874 „Im Namen Gottes, des Allmächtigen“ gegründet? Wenn nun Gott, so ein schlechter Kommunikator ist, warum bestand Barack Obama darauf, seine Hand bei der Vereidigung auf die Bibel Lincolns zu legen. Und warum haben wir noch 1999 unsere Bundesverfassung schon wieder oder immer noch mit den Worten „Im Namen des Allmächtigen“ beginnen lassen. Vielleicht hat ein ETH-Naturwissenschaftler eine mathematisch präzise Antwort auf solche Fragen? Andernfalls möge er sich aus den Erörterungen historischer Zusammenhänge heraushalten.

      • Rocket sagt:

        @Giorgio Girardet, die Verfassungen wurden von Menschen geschrieben, oder? Von Menschen aus Fleisch und Blut die fantasievolle Texte wie

        – Der Wolf und die sieben Geisslein
        – Die Protokolle der Weisen von Zion
        – Die Brüder Karamasov
        – Mein Kampf
        – Harry Potter
        – …

        schreiben. Warum sollte ausgerechnet in einer Verfassung nicht auch mal etwas fabuliert werden? Als Historiker sollten Sie doch auch verstehen, dass der Mensch immer versucht die Gemeinschaft zu verstärken (v.a. wenn sie von aussen bedroht wird) und nach innen, so zu verändern wie es seinem Weltbild entspricht. Entsprechend ist die Gottesanrufung eine sinnvolle Sache, aber keinesfalls ein Gottesbeweis. Sie hat(te) schlicht und einfach eine politisch-soziale Funktion.

        Ich denke man kann heute der Ansicht sein, dass wir unser Staatswesen auf etwas anderes als auf einen ominösen „Gott“ stellen können. Z.B. auf Errungenschaften wie Demokratie, Gleichheit vor dem (menschengegebenen) Recht u. dgl.

    • Vollkommen einverstanden.

    • Ich Spende jedem Mamablog-Leser eine gute Weinflasche, der mir einen Staat nenen kann, einen existierenden oder verflossenen, der eine totale und vollständige Trennung von Kirche und Staat, von Religion und Staat kennt oder kannte. Also ein Staat, in dem „Gott“ nicht in Hymnen und Lieder vorkommt und der den Religionen auf seinem Territorium die Religionsfreiheit gewährt. Bisher hat mir noch niemand einen solchen Staat nennen können. Aber ich will es nich als aussichtslos ansehen. Also: gesucht ein Staat, in dem die Trennung von Staat und Religion total durchgefürht wird, so wie es der SP-Jungspung Wermuth sich wünscht. Ich möchte einen solchen Staat kennenlernen.

      • Orlando S. sagt:

        Nordkorea?
        Man hört die Protestanten seien dort recht frei in der Ausübung ihres Glaubens.

      • Andi Koch sagt:

        Giorgio, was versprichst Du Dir davon; dass Wahrheit, Realität dadurch bewiesen ist, dass die meisten oder alle von uns an etwas glauben?
        Vor 40 y waren die Frauen in unserem Land politisch gesehen mit Tieren gleichgestellt.

        Religionen sind menschliche Projektionen ins Vakuum. Der Inhalt ist irrelevant. Das Prinzip ist interessant: Immer geht es um etwas Höheres, Mächtigeres, dem man sich unterwerfen muss (v.a. monotheistische Hirnviren) oder das sonst auf eine Art unberechenbar und z.T. zornig werden kann (antik-griechische Götter). Die interessante Frage ist: Wie evolvierte der Glaube an ein Leben im Jenseits und an einen Gott, der mit diesem Jenseitsetwas zu tun hat. Die Antworten dazu suche ich bestimmt nicht in einem alten staubigen Buch, das von Menschen verfasst wurde, die Epileptiker als vom Teufel Befallene anschauten. Die Antworten suche in der Biologie und Evolution (biolog. u. kulturelle) der Primaten. Wo denn sonst?

    • Globetrotterin sagt:

      Trennung von Kirche und Staat? Wie kann dann der Staat noch immer als Steuereintreiber für die Landeskirchen fungieren? Wie kommt es dann, dass Lehrstühle für Theologie noch immer von Herrn und Frau SteuerzahlerIn berappt werden?

  • Steiner M. sagt:

    Die selbsernannten Herren „Freidenker“ mit Fernseher und DVD zu Hause, die ihre Kinder magische Harry-Potter Filme schauen lassen, dafür Angst haben, diese könnten in der Schule versäucht werden und anfangen zu Gott zu beten? Lächerlich! Es ist offensichtlich, dass diese Männer schon lange nicht mehr frei denken können, sowie die meisten Menschen in unserer Gesellschaft, die schon seit Jahrzehnten indoktriniert werden von der Hollywood-Propagandaindusrie und ihre Kinder mit diesem Gift grossziehen. Es geht hier längst nicht mehr um die Aufklärung, sondern um das Lebensgefühl einer scheinbaren Freiheit, welche sie alle längst in eine grosse Abhängigkeit geführt hat.

    • Leo sagt:

      Es gibt eben auch bei den Freidenkern drei Gruppierungen
      1. Totale Fundamentalisten mit Anspruch auf Wahrheit, Dogma im schlimmsten Sinne
      2. Gleichgültige, unverbindliche, Windfahnen,
      3. So genannte Normalos, die zwar glauben, dass sie NICHT glauben, dies auch kommunizieren ohne zu missionieren, aber den Rest, die andern einfach leben lassen und sogar offen bleiben für Diskussionen, Gespräche, andere Ansichten, andere Argumente und Neugierig sind.

      • Nemo sagt:

        Warum muss man die Menschen immer und immer wieder Katalogisieren? Leben und leben lassen!
        Aber es gibt 3 Arten von Leben und leben lassen!..
        1…. 🙂

  • Nicole sagt:

    Ein Sechsjähriger, der grundsätzlich schon weiss, dass er nicht an Gott glaubt? Das nenne ich Indoktrinierung durch die Mutter. Ich bedaure den Kleinen. Religiöse Geschichten und Bräuche haben einen schönen Teil meiner Kindheit ausgemacht, auch wenn meine Eltern keine Superchristen waren.

  • Elli sagt:

    Ein schöner und treffender Artikel. Nur ein Satz gefällt mir ganz und gar nicht. Nämlich dieser hier:

    „Gründen letztlich nicht auch humanistisch-ethische Werte auf einem aufgeklärten Glauben?“

    Nein, tun sie nicht. Die Vorstellung, dass humanistisch-ethische Werte eine Erfindung von patriarchalen Monotheismen sein sollen, ist geradezu lächerlich. Es ist ja nicht so, als wären vor dem Christentum alle Menschen inhuman, unethisch, asozial und bösartig gewesen.

    Aber es gehört eben zur allgemeinen historischen Gehirnwäsche der Monotheisten zu verbreiten, dass sie die Menschlichkeit quasie erfunden hätten.

    • zysi sagt:

      wer hat sie denn erfunden die menschlichkeit und was ist sie?

    • Robert sagt:

      Monotheisten haben das eben so in ihrem Programm drin. Steht doch auch in der Bibel. Was sollen die anderes behaupten?

      Es würde ja schon reichen, dass HEUTE Menschlichkeit möglich ist in unserer doch recht säkularen Welt. Ich glaube z.B. nicht, dass die Überlegung einer Frau eine Abtreibung zuzugestehen besonders alt ist – aber doch m.E. heute humanistisch-ethisch vertretbar (hoffentlich sage ich jetzt nicht falsches, BIBBER).

      • Benjamin Hitz sagt:

        Sie sagen nichts falsches, aber die von ihnen erwähnte Frage ist tatsächlich schon ziemlich alt. Im Mittelalter vertrat das Christentum hierzu noch die These, dass Abtreibung zwar immer eine Sünde ist, diese Sünde aber je nach Alter des Fötus noch büssbar wäre. Hintergrund dieser These war die Auffassung, dass ein Fötus schrittweise beseelt würde. Meines Wissens galt diese Lehrmeinung von ca. Mitte des 12. bis ca. Mitte des 19. Jahrhunderts.

  • Evil Ernie sagt:

    @ Martin Rüedi: das grundsätzliche Problem der Gläubigen ist auch immer der IRRglaube.
    Wenn Sie ihre Aussage genau umdrehen kommen sie der Wahrheit ein ganzes Stück näher:
    Es gibt nicht einen positiven Grundsatz von Jesus Christus, falls es ihn gab, der nicht schon lange vor ihm durch den Humanismus z.B. von irgendwelchen „alten Griechen“ definiert wurde.
    Nachhilfe in Geschichte gibts z.B. mit dem Suchbegriff „Humanismus“ bei Wikipedia.

  • Aus diesem Blog ist wieder schmerzhaft ersichtlich: die Religion schafft Grenzen, Mauern und Zwiespalt. Brauchen wir das diese Tage?

    Ich kann jedem nur wärmstens empfehlen, sich den Film „Zeitgeit – Teil1“ anzuschauen, am besten in Original-Englisch. Dann ein wenig bei Wikipedia googlen, und es erübrigen sich viele der Streitgespräche hier. Und bitte auch den Kids zeigen – es öffnen sich viel interessantere Wissensgebiete als die Lehre der Bibel: Evolution, Ägyptologie, Astrophysik, Psychologie, usw.

    Zeitgeist – Teil1
    http://video.google.com/videoplay?docid=2740987755232169561#

    Hier noch begleitende Literatur zu dem Film (Kapitel Astro-Theologie)
    http://www.zeit-wen.de/pages/book/zeitwende.html

    Herzlichst,
    Henning Kuersten

  • Auguste sagt:

    hmm…, in einem wachen geist hat auch der glaube platz – in einem klugen geist nicht uneingeschränkt.

    youtube: brooks & dunn – believe

    • Orlando S. sagt:

      Sie überraschen mich heute positiv.

      Ist Ihnen aufgefallen, dass hier fast nicht gesmilt wird heute? Wieso bloss? Glaube und Gott sind doch eigentlich keine so freudlosen, traurigen Themen…“Und siehe, die Welt ist nicht verloren!“

      daher:

      🙂
      🙂
      😀
      😉

  • Renegade sagt:

    Liebe Frau Binswanger, wenn Ethik überhaupt begründet werden kann (diese metaethische Debatte klammern wir der Einfachheit halber mal aus), dann selbstverständlich völlig ohne irgendeinen Rückgriff auf die christliche Wirkungsgeschichte o.Ä. (und a fortiori erst recht ohne Rückgriff auf Gott). Ihre Behauptung hier enthält m.E. die Gefahr, auf die in Religionskreisen nicht so unübliche, doch meist kaum begründete Behauptung „Ohne Religion ist keine Ethik möglich“ hinauszulaufen, was aus Sicht philosophischer Ethik nun mal – deutlich ausgedrückt – schlichtweg Quatsch ist.

    Denn inwiefern ist z.B. der Utilitarismus, die Diskursethik, der Kontraktualismus, die Tugendethik oder selbst die Kantianische Deontologie in ihren Begründungsprogrammen irgendwie von einer christlichen Wirkungsgeschichte abhängig? Der Kategorische Imperativ, als Beispiel, benötigt gerade nichts anderes als die Vernunft für seine Begründung (ob die dann tatsächlich gelingt oder scheitert, lassen wir hier wiederum offen). Da macht es auch keinen Unterschied, dass Kant Christ gewesen ist. Davon ist die Begründung nicht abhängig.

    Wenn es um das Verständnis der Kultur geht, da hingegen gebe ich Ihnen gerne recht, dass Kenntnisse der christlichen Wirkungsgeschichte etc. wichtig sind. Bei der Wissenschaftsgeschichte würde ich sagen, ist es vielleicht fraglich, inwieweit man umfangreiche Kenntnis christlicher Wirkungsgeschichte dafür braucht, oder ob das, was man zum Verständnis der Wissenschaftsgeschichte benötigt , auch durch kleinere Exkurse innerhalb der Wissenschaftsgeschichte ausreichend abgedeckt werden könnte (für die modernere Wissenschaftsgeschichte wird christliche Wirkungsgeschichte etc. jedenfalls bereits eine deutlich geringere Rolle spielen als z.B. für die scholastische Wissenschaftsphase etc.; und wenn es um die Anfänge der Wissenschaft in der griechischen Antike geht, spielen christliche Hintergründe freilich erst recht keine Rolle).

    Entscheidend scheint mir, dass Sie bei diesen beiden letztgenannten Punkten – Kultur und Wissenschaftsgeschichte – von „Verstehen“ sprechen, und nicht von „Begründen“. Was aber für das Verstehen einer Sache relevant sein kann, muss es in keiner Weise für das Begründen einer Sache (philosophisch würde man da wahrscheinlich von einem „genetischen Fehlschluss“ sprechen, nähme man das Gegenteil an). Hätten Sie geschrieben, dass unsere heutigen alltäglichen Moralvorstellungen und v.a. auch moralischen Intuitionen in unserer Kultur nur verstanden werden können, wenn wir Kenntnis von der christlichen Wirkungsgeschichte etc. haben, hätte ich Ihnen nicht widersprochen.

    Aber ob diese alltäglichen Moralvorstellungen auch richtig sind – und gut begründet -, das ist eine ganz andere Frage, und eben eine, wo wir keineswegs auf christliche Geschichte oder Inhalte zurückgreifen müssen, und vielleicht sogar gerade auch nicht sollten – weil eine Ethik, die so etwas wie Universalität beanspruchen möchte, auf etwas Allgemeinerem als einer spezifischen Kultur oder spezifischen Glaubensinhalten, auf die sich nicht alle berufen und berufen wollen, begründet sein muss.

    • Fernando sagt:

      Ich glaube, man muss Frau Binswangers Rede vom „Gründen“ nicht im dem Sinne von „Begründen“ lesen, den Sie hier darlegen, und dieser Sinn war wohl auch nicht intendiert, ansonsten wäre der Text tatsächlich ziemlich schwach… Die Autorin wird uns sicher noch aufklären; bis dahin schlage ich vor, den Grund hier im Sinne von geschichtlichem Ursprung zu verstehen. Dann passt es auch wieder zu Ihrem Vorschlag.
      Ich würde in Bezug auf die genetische Frage sogar noch einen Schritt weiter gehen und fragen, ob nicht bloss unsere Moralvorstellungen, sondern gleichsam das ganze Projekt einer universalen Ethik und die Suche nach ihrer Grundlage (hier in Ihrem Sinne von „Grund“) nur im Hinblick auf die christliche Tradition richtig zu verstehen ist…

      • Michèle Binswanger sagt:

        @Fernando: Genau, es geht bei der Frage nach den humanistischen Werten meiner Meinung nach darum, deren Genealogie aufzuzeigen – Gründen also im Sinne von Herleiten.

      • Rocket sagt:

        @Fernando & Frau Binswanger: Dann müsste man aber auch ein korrektes Etikett draufkleben und deutlich sagen:

        So Kinder, wir machen jetzt Ethikgeschichte. XYZ…, das war der Hinduismus. Und dann, vor ca. 2000 Jahren, kam das Christentum, die fanden AUCH, dass man sich nicht bestehlen soll und dass man sich nicht gegenseitig töten soll, sie stützten sich v.a. auf jüdische auber auch auf assyrische Quellen. Weiter mit dem Sikhismus. ABC…

        Aber es geht nicht, zu insinuieren, nur im Christentum (oder in überhaupt irgendeiner Religion) läge das Heil. Epikur und die Stoiker müssen auch vertreten sein, ebenso wie andere areligiöse Beiträge zur Ethik. Religion ist keine notwendige Bedingung für die Existenz einer Ethik (welche, da wurde richtigerweise schon drauf hingewiesen, nicht leicht zu fassen ist).

  • David Wiedemann sagt:

    @tobe or not tobe:
    Danke, dass Du mich so mündig einschätzt, dass ich in über 30 Jahren leben auf dieser Erde mit vielen Menschen, mit reisen in der ganzen Welt, mit persönliche Krisen, tollen Erlebnissen und Erfolgen immer noch völlig abhängig davon bin, was mir andere sagen 😉

    Eine Beeinflussung fand sicher statt – aber trotzdem komme ich nicht darum herum, mir selber all die Fragen zu stellen, und sie für mich selber zu beantworten.

    Und womit ich Mühe habe: Wieso wird mir als Christen dauernd unterstellt, dass das, was ich erlebe, gar nicht so sei, sondern ich mir das nur einbilde? Das finde ich nicht ganz fair – weil auch nicht als voll genommen (Yep, ich erlebe diesen Gott eben wirklich in meijnem Leben).
    Und spätestens da wäre es Zeit für all die Atheisten, sich einen Satz aus der Bibel zu Herzen zu nehmen: Bevor Du den Splitter aus dem Auge Deines Nächsten entfernen willst, nehme den Balken aus Deinem eigenen Auge…

    • Globetrotterin sagt:

      Den Satz mit dem Splitter im Auge kann man auch vice-versa benutzen. Dann macht er mehr Sinn.

      • David Wiedemann sagt:

        Hmm, indem Du sagst „…macht er mehr Sinn“, wertest Du gerade wieder und stellst Dich sozussagen über mich (oder eben, diejenigen, die nicht Deine Meiung vertreten).

        Dass dieser Satz für mich genau so, wie für jeden Anderen Menschen – Fanatiker, „normal-gläubiger“ (möchte das nicht ausdiskutieren), liberaler, nicht-an-Gott-glaubender, an-einen-eigenen-Gott-glaubenden, (… Liste könnte unendlich weitergeführt werden), dessen bin ich mir sehr wohl bewusst und stelle ich auch nicht in Abrede… Aber eben, für alle gleich.

    • tobe or not tobe sagt:

      @David: Schau ich könnte dir jetzt 24 stunden lang erklären was ich glaube und am Ende hast du gleich deine Sichtweise, wie auch alle anderen es haben.

      Ja mein Balken der dürfe gross sein, aus Deiner Sicht, könnte

      Aber nur ein Tipp, wenn Du dich als mündig betittelst..: Sei kritisch aber konstruktiv, den dein Gott liebt Kritiker die seine Welt voranbringen und keine Schäfchen die nicht aus der Reihe tanzen. Sogar der Jesus ist aus der Reihe getanzt!! Aber Die Kirche möchte dich in REih und Glied stehen sehen…

      Der ware Christentum wäre menschenliebend, doch die Kirche menschenverachtend…

    • Robert sagt:

      Sie haben recht. Mich hat mal jemand dazu gebracht, eines der Bücher dieses Neale Donald Walsch anzufangen zu lesen – ganz geschafft hab ich es nicht. Interessant war das, insbesondere, weil es so viele Menschen gibt, die sich in diesen Botschaften von Walsch wiederfinden.

      Ich muss also anerkennen, dass jemand eigentlich in allem Gott erkennen kann und tatsächlich dauernd mit Gott spricht, indem er der Auffassung ist, dass all seine Gedanken Äusserungen von Gott sind. So kann ich mir das tatsächlich vorstellen, dass jemand an Gott glaubt.

      Was mich aber immer wieder umtreibt ist die Frage: Wie kann jemand so sicher sein, dass da tatsächlich Gott in allem ist?

      • tobe or not tobe sagt:

        @Robert: Die Kunst der Selbstheilung beginnt mit diesr Fähigkeit, in allem seinen Gott, göttliche Energie oder was für jeden halt stimmt, zu sehen.. Und die wirkt, wie sie sich auch einbilden können Krank zu sein (Hypochonder)

        Und genau dieser Gott, mit dem jeder in sich spricht, ist man selber , den jeder ist ein Teil dessen was die Monotheisten Gott nennen…

  • tobe or not tobe sagt:

    ich habe damals das Gespräch mit meinem katholischen Pfarrer gesucht und ihn nach einer guten Begründung gefragt, wieso mich die Kirche betrieben hat!!!!

    er wich mir aus und erzählte was von Nächstenlieben. Nächstenliebe wär ein Schuldenerlass gewesen, aber dank denen hatte ich dann noch einen Lohnpfändung.

    Aber zwischen Glauben und Kirche ist ein groooooooosser Unterschied!!

    • Die Möglichkeit zum Kirchenaustritt ist eine Errungenschaft des „Liberalismus“. Theologisch ist der „Kirchenaustritt“ ein Unding. Vielleicht müssten wir zu einer Kirchenverfassung zurückkehren, wo die Mächtigen und Reichen Kirchen bauen und die armen Leibeigenen dann „gratis“ in den Gottesdienst gehen. Das hätte weit mehr mit „Nächstenliebe“ zu tun: Wer das Geld und die Macht hat spendet und zwingt dann aus Nächstenliebe die Beglückten zur Dankbarkeit.

    • Globetrotterin sagt:

      @tobe:
      Weshalb treten bzw. traten Sie nicht längst aus einer solchen Kirche aus? Dann erledigt sich das mit der Kirchensteuer und den Betreibungen von selbst.

      • tobe or not tobe sagt:

        @Globetrotterin: Ist passiert. War von 10 Jahren der Fall. Nach dieser Betreibung habe ich umgehend den Rücktritt gegeben… Habe dem Pfarrer dies persönlich noch mitteilen wollen und auch ihnm seine Unwissenheit vorzuhalten. Er fand keine Worte mehr. Danach habe ich mich intensiv mit der Bibel, Koran und anderen Religionen ausseindergesetzt.

        Heute bin ich auf den Schluss gekommen, das wie auch in dieser Diskussion hier, niemand seinen eigenen Glauben einem anderen Menschen erklären und schon gar nicht aufzwingen kann.

        Frei ist die Seel und weit das Universum… 🙂

  • Bruno Waldvogel-Frei sagt:

    @Tom. Vielleicht sollten Sie etwas mehr Tierfilme ansehen. Dann würden Sie keine solchen Behauptungen mehr über Töten im Rudel machen. Beispiel gefälltig? Löwenmännchen töten regelmässig ihre Jungen.

    • Hans Mustermann sagt:

      Was natürlich eigentlich Unsinn ist. Die eigene Jungen töte das Männchen keineswegs. Nur wenn ein Rudel von einem neuen Löwenmännchen übernommen wird tötet es vieleicht die jungen Nachkommen seines Vorgängers sofern diese noch gesäugt werden. Grund: Die Löwin wird früher empfängnissbereit und er kann seine Gene daher früher weitergeben.
      Weitaus häufiger werden allerdings „fremde“ Löwen eines anderen Rudels getötet. Wie bei den Menschen meist aus Resourcengründen.

  • Chris sagt:

    Zu Ihrer Aussage:

    „Wenn man die Gottesvorstellung mit all ihren Implikationen konsequent ausmerzt, macht das Kinder meiner Meinung nach eher anfällig dafür, sich später umso radikaler dazu bekehren zu lassen.“

    … Soll man also ab und zu doch mal den einen oder anderen Theologen zwecks Indoktrination an die Kinder ran lassen?

    Warum sollte sich ein gesund entwickelter Mensch, der in der Schule über Scharlatanerie/Religionen aufgeklärt wurde, später selbst einer Religion verfallen oder auf religiöse Fanatiker reinfallen? Wer über die verbrecherische Geschichte der Religionen, den Betrug an der Menschheit durch Theologen, den psychologischen Aspekt von Religiosität etc… als Kind und Jugendlicher aufgeklärt wurde – wieso sollte ein Mensch dann als Erwachsener plötzlich verblöden? Der Gedankengang erscheint mir völlig unplausibel.

    Kinder müssen vor christlichen oder islamischen Theologen genauso geschützt werden, wie sie auch vor Kriminellen, Vergewaltigern, Nazis, Scientologen oder anderen Spinnern geschützt werden müssen. Es gibt keinen Grund sie einer religiösen Indoktrination preiszugeben. Absolut keinen.

    • Robert sagt:

      Stimmt! Impfen tut man mit toten oder stark geschwächten Viren. Kein Mensch würde sein Kind mit echtem Ebola zu impfen versuchen…

    • Fernando sagt:

      Die Frage ist, auf welcher Grundlage man denn die Gottesvorstellungen ausmerzen will. Im Namen der Vernunft? Welcher Vernunft – etwa der wissenschaftlichen? Das Problem ist doch, dass Sie Ihre Abwehr des Religiösen nicht mit dem Verweis auf etwas begründen können, das selbst auf einem letztendlich reichlich unsicherem Fundament steht. Es sei denn, sie nehmen dabei die Tatsache in Kauf, dass Sie damit den Reflex der Religionsanhänger gegenüber allem andern einfach wiederholen: Während diese die Früchte des aufklärerischen Gedankenguts umso vehementer als Verirrung bekämpften als ihnen eine vernünftige Basis dafür fehlte, setzen Sie nun diesen Kampf einfach mit anderen Vorzeichen fort, indem Sie die heranwachsenden Mitglieder unserer Gesellschaft vor den „bösen“ Theologen schützen wollen… Doch die (psychologische) Struktur des Ganzen bliebt dieselbe, und darum ist es auch ganz natürlich, von einer Seite zur andern zu wechseln. Darum kann ich diesbezüglich dem von Ihnen zitierten Satz von Frau Binswanger nur zustimmen.
      Aber warum denn eigentlich dieser ganze Groll gegen alles Theologische? Immerhin hat doch die Kirche in unseren Breitengraden ihre Definitionsmacht längst den Wissenschaften und der Werbeindustrie abgegeben.Was kann da ein Religionslehrer überhaupt noch bewirken? Meiner Meinung nach rührt dieser Abwehrreflex nicht zuletzt auch daher, dass es ziemlich unangenehm (weil anstrengend) sein kann sich einzugestehen, dass die Art und Weise, wie wir heute denken, inklusive alles Aufklärerischen, wesentlich von der christlichen Tradition geprägt ist. Daran gilt es jedoch sich abzuarbeiten. Gegen Theologen zu schimpfen nützt da nichts!

      • Rocket sagt:

        Der religiöse an jedwelche Religion steht dafür NICHT WISSEN mit DOGMA (gefühltem Wissen) zu ersetzen und das ist gefährlich. Nachdem wir endlich diese religiöse UNvernunft aus dem Alltag verdrängt haben müssen wir Sorge dazu tragen, dass sie auch draussen bleibt. Leider feiern diejenigen, die Nichtwissen durch gefühltes Wissen ersetzen Urstände, siehe Komplementärmedizin-Debatte u.v.m.)

        Es geht nicht darum ob gerade das Christentum falsch oder richtig ist oder irgendeine andere Religion. Es geht darum, dass jeder Mensch weiss, dass es Dinge gibt, die wir (noch) nicht wissen und das akzeptiert und sich dagegen wehrt, dass es mit irgendeiner gefühlten/gottgegebenen Wahrheit substituiert wird.

  • Markus Sennheiser sagt:

    Jergendwann kommt Ihr Kind in Lebensituationen die Entscheidungen treffen muss und evtl. vor Versuchungen steht.
    Drogen, Selbstmord etc… Ein bisschen christliche Werte und etwas Glauben kann durchaus etwas unter die arme greiffen.. Christentum befasst sich nähmlich nicht nur mit der Frage woher wir stammen im gegensatz zum Freidenken oder Atheismus.
    Richtig angewendet verhilft es uns in der sekularen Welt etwas besser zurecht zu kommen. Denn diese ist ja nicht immer das gelbe vom Ei.

    Seit den ersten Höhlenbewohner sollte uns klar sein dass der Mensch eine spirituelle Neigung hatt, vielleicht evtl sogar einen solchen unendeckten GEN besitzt. Wer weiss…
    Alleine die Leute dovon überzeugen zu wollen dass kein Gott existiert ist es damit nicht getahn. Oft schauen sich die nach der Wahrheit suchenden nach alternativen um. Willkommene Opfer für Esotheriker, Wahrsager und sonst was der sekuläre Markt aus finanziellen Interessen alles bietet.

    Habt Ihr dann solche Opfer in der Bekannschaft oder sogar Familie wird Euch erst dann klar wie vernünftig christliche Werte und Glaube sind.

    Erkentniss alleine wirkt sich nicht immer nur positiv aus:

    Hätte ich in meinen jüngeren Jahren ,trotz guter Elternhaus-Erziehung, die 100% erkenntniss gehabt dass Gott nicht existiert, wäre meine Hemmschwelle einiges tiefer angesezt gewesen. Damit evtl. auch geneigt dazu gewesen sich in gefährlicher Gewässer zu wagen oder in der Gesellschaft sich etwas egoistischer und rücksichtsloser zu verhalten.

    Sollte Gott doch nicht existieren dann werde ich dies keine Sekunde nachreuen, den der glaube an Gott stärkt auch den glauben und Karakter an sich selbst und mache Türen sind mir deswegen in der Sekulären Welt geöffnet worden. Job, Karriere, wahre Freundschaften etc

    Ob die Schule der richtige Ort dafür ist kann durchaus in frage gestellt werden, aber Kinder so früh wie möglich sie damit befassen zu lassen kann ich nur empfehlen. Denn mache Fehler im Leben sind unrückgänglich um daraus Lehren zu ziehen.

    ..

    • Rocket sagt:

      Noch so viel Christentum wird die Menschen nicht davon abhalten „Fehler“ zu begehen, darüber dürfen wir uns auch mit solchem Gewölk nicht hinwegtäuschen. Übrigens will niemand die Leute davon überzeugen „dass es kein Gott gibt“. Ich und einige andere sehen einfach keine vernünftigen Hinweis darauf.

      Wenn es euren Gott gibt, warum hätte er uns dann einen rationalen Geist geben sollen, um ihn zu hinterfragen?

      Weiter behaupten Sie, dass, wenn sie nicht gläubig gewesen wären, ein Mensch „mit tieferer Hemmschwelle“ gewesen wären. Dass ist doch das selbe, wie wenn ich behaupten würde, als gläubiger Katholik wäre ich sicher ein Kinderf***er geworden (muss ja so sein, als Katholik). Lassen Sie doch bitte diesen himmelschreienden Unsinn. Man muss nicht gläubig sein um ein „guter“ Mensch zu sein.

      Im zweitletzten Absatz geben Sie zu, dass Sie v.a. im Networking vom Glauben profitierten. Schön für Sie, dennoch habe ich mehr Respekt vor einem Atheisten, der seine Stellung durch Leistung erreicht, als weil er die „richtige“ Religion hat. In Thailand würde Ihnen Ihr Christentum nicht viel helfen…

  • SiVoe sagt:

    Selbst der Glaube an die Evolution und die ethischen Werte ist ein Glaube. Selbst daran zu glauben, dass es keinen richtigen Glauben gibt, ist für diejenige Person der richtige Glaube. Also wenn eine Freidenkerin so freidenkerisch ist wie sie sich gibt, dann hätte sie auch kein Problem wenn ihr Sohn Christ wird. Hat sie aber. Was für ein Wiederspruch!

    • Murks sagt:

      Die Evolution muss man nicht glauben, die kann man beobachten.

      • Gianin May sagt:

        Ich glaube nciht an den 7Tage Kreationismus, aber es heisst noch immer EvolutionsTHEORIE. Das muss natürlich so sein, damit man diese immer wieder den neusten Erkenntnisse anpassen und revidieren kann ohne Gefahr zu laufen, dass man sich denselben Vorwürfen aussetzen muss, die den Christen vorgeworden sind, wenn sie Sachverhalte aus der Bibel anders interpretieren als es die RKK in den vergangenen 1500 Jahren gemacht hat oder diese der EvolutionsTHEORIE angleichen suchen.

        Neue Erkenntnisse werden der Wissenschaft zugestanden, nicht aber den Christen, wobei die Trennung zwischen diesen beiden ein Politikum war und nicht wissenschaftlich begründet werden kann.

      • fufi sagt:

        @Murks:

        Bitte DRINGENDST um ein Beobachtungsprotokoll!

      • Obelix sagt:

        Ich habe letzthin gelesen, dass ein Schimpansenpärchen im Zoo ein menschliches Baby zur Welt gebracht hat. Hm, oder doch nicht?

      • fufi sagt:

        @Obelix
        Habs umgekehrt gelesen, aber mag mich auch verlesen haben?

    • Robert sagt:

      Die Freidenkerin hätte wohl ein Problem damit, wenn der Sohn nicht in Betracht ziehen würde, dass er sich vielleicht irrt.

  • Papi sagt:

    Auch freidenker könnte man bezeichnen als Gläubigen: Ein Glauben an der nicht existenz einer Göttlichen Entität. Einen wissenschaftlichen beweiss steht noch immer aus, und somit bleibt auch dies nur ein Glauben. Der Eifer die Freidenker manchmal an den Tag legen hat schon ziemliche Religiöse züge.
    In dem Sinne frage ich mich was Frau Binswanger genau meint mit: „… und religiöse Intoleranz anderer nicht tolerieren“
    Ist es in dem Sinne nicht so dass wir die Intoleranz der Freidenkern dann auch nicht tolerieren sollten? Es ist ja wohl klar das die Freidenker sich ziemlich unversöhnlich und intolerant bezüglich dem Religiösen verhalten.

    „Statt «christlicher Werte», so fordern die Freidenker, sollte in einem solchen Fach konsequente Ethik unterrichtet werden“
    Ethik / Ethische Werte werden von Freidenker wie eine Keule verwendet. Fragt man aber einen Freidenker was dann die viel gelobte Ethische Werte sind, was das Fundament der Ethische Werte eines Freidenkers ist bekommt man keine Antwort.
    Ich vermute, dass die meisten Freidenker das Wort „Ethische Werte“ dann auch nur als leere Worthülse verwenden ohne zu wissen was diese Ethische Werte im sinne vom „Atheistischen Glauben“ dann genau bedeuten.

    • Globetrotterin sagt:

      Der Irrtum, dem die Religionsverteidiger immer wieder aufsitzen ist der, dass wohl derjenige, der die Existenz eines Gottes behauptet, deren Nachweis erbringen muss. Die Forderung, die Existenz von Nichts nachzuweisen hingegen, ist völlig absurd.

      • zysi sagt:

        Die Forderung, die Existenz von Nichts nachzuweisen hingegen, ist völlig absurd.

        interessant, dass sie sich mit den vereinigten cern-gläubigen auf eine absurde ebene hieven…

      • Papi sagt:

        Sie machen da einen gewaltigen Denkfehler
        1) Es heisst Glauben, der Religionsverteidiger muss also keinen beweiss erbringen. Wenn etwas bewiesen wäre, wäre es kein Glauben mehr.
        2) Sagt Ihnen Falsifikation was?. Die These ist: Es gibt einen Gott. Die Falsifikation ist jetzt der Nachweis der Ungültigkeit dieser These. Und genau dieser nachweiss hat noch kein einziger Freidenker erbracht, obwohl sie behaupten das es keinen Gott gibt

      • Orlando S. sagt:

        Kann man Liebe „beweisen“?
        Intelligentere Männer als sie und ich haben sich darüber den Kopf zerbrochen, gnä Frau.

        Schon mal was von Ockhams Rasiermesser gehört?

      • Globetrotterin sagt:

        Ja, ja, Orlando. Einfachheit und Schlichtheit prägen auch Ihre Gedankengänge.

      • Orlando S. sagt:

        Drum blicke ich auch klarer durch als sie, Madame.
        Schachmatt in 3 s!

      • Rocket sagt:

        @Papi, Zysi und Orlando. Es ist tatsächlich nicht möglich eine universelle Nichtexistenz zu beweisen, z.B. werden Sie auch schwerlich den Nachweis erbringen können, das ein fliegendes Spaghettimonster NICHT exisitert. Wenn ich ein solches postulieren würden, würden Sie zurecht von MIR verlangen, einen Nachweis dafür zu erbringen.

        Aussergewöhnliche Behauptungen erfordern aussergewöhnliche Belege. Und die Existenz eines Gottes (oder mehrer Götter) ist gegenüber der Existenzbehauptung bezügl. Liebe tatsächlich aussergewöhnlich. Ich habe jedenfalls in meiner Lesekarriere und in meiner sonstigen Lebenserfahrung noch nie mit jemandem Kontakt gehabt, der die Liebe als Emotion und ihre Konkretisierung in Handlungen bestritten hätte.

      • Brunhild Steiner sagt:

        @Rocket: das fliegende Spaghettimonster hat mir bislang aber keinerlei Hilfestellung für Themen die mit Vergebung und Barmherzigkeit zu tun haben, geliefert.
        Zudem fände ich es auch nicht besonders erfüllend meine Dankbarkeit und Freude über die Natur, die kleinen Details, Gelungenes und Überwältigendes, das mich geliebt-und angenommen-fühlen/wissen, oder auch meine Sorgen, meine Trauer, meine Verzweiflung einem neuzeitigen fliegenden Spaghettimonster auszudrücken resp. anzuvertrauen.
        Und ob da diesselbe Portion Leibe, Trost, Ermutigung und Wiederherstellung/Ermutigung zurückkäme?
        Oder bloss ein Klecks Tomatensauce zur Verschönerung des Alltags?

      • Papi sagt:

        @ Rocket

        Sie machen den gleichen denkfehler:
        Sie müssen auch nicht die universelle Nichtexistenz beweisen, Sie müssen nur die These: es gibt einen Gott Falsifizieren

      • Orlando S. sagt:

        @Rocket. nicht „die Liebe“, sie Narr!

        Liebe.

      • Orlando S. sagt:

        …Gott ist doch kein Vorgang in der Natur oder eine Denkfigur! Und ist nicht gerade das Scheitern der Beweis- und Herleitungsverfahren, die der Mensch beherrscht, ein weiterer Beweis dafür, das Er genau in der „Form“ existiert, wie Er beschrieben wurde?

        Verweise auf meinen freistehenden Post von 15.10.

      • Rocket sagt:

        @ Papi, ich empfehle ihnen ein einführendes Buch über Prädikatenlogik oder als Hörer eine entsprechende Vorlesung an der Uni/ETH zu besuchen. Falsifizieren der These der Existenz von A ist äquivalent zum Nachweis der universellen Nichtexistenz von A und der Denkfehler liegt bei Ihnen.

        @ Brunhild Steiner, das Spaghettimonster ist eine polemische Überspitzung und dient lediglich zur Illustration der Absurdität. Z.B. in Analogie zu sprechenden Schlangen, Schiffen die alle Tiere aufnehmen, Frauen die ohne von einem Mann berührt zu werden schwanger werden u. dgl. Jesus und der christliche Gott war damals auch „neuzeitlich“, das kann also kaum als Argument dienen. Da ich davon ausgehe, dass es tatsächlich keine Rolle spielt welche Art von höheren Wesen sie verehren bzw. als spirituellen Katalysator einsetzen, könnte dieses „Einssein mit der Welt“ auch vom fliegenden Spaghettimonster kommen. Probieren Sie es doch mal aus und lassen sie uns an Ihren Erfahrungen teilhaben. Scheinbar haben mehrere Milliarden Menschen ähnliche spirituelle Erfahrungen mit komplett anderen (u. m.M.n. ebenso absurden) theologischen Konstrukten. Deshalb scheint die Einzigartigkeit der christlichen Mythologie einigermassen unglaubhaft.

      • Papi sagt:

        @ Rocket

        Wenn auch nicht ganz zutreffend, sage ich nur Nullhypothese

      • Rocket sagt:

        Papi, die Nullhypothese ist ein Begriff aus der Statistik und kann mittels statistischer Tests mit einer gewissen Wahrscheinlichkeit verworfen bzw. bestätigt werden. Ich sehe den Zusammenhang nicht, da wir hier eine Fragestellung aus der Logik erörtern.

        Oder haben Sie etwas statistische Daten, die Gottes Existenz belegen? Da wäre ihnen wohl die grosse öffentliche Aufmerksamkeit sicher.

      • Gianin May sagt:

        Wieso? Ich brauche diesen Beweis nicht. Sie hingegen schon.

    • Auguste sagt:

      hmm…, ein problem der heutigen freidenker ist, dass die ethischen grundlagen, auf die sie sich so vehement berufen, lange schon vor ihrer clubgründung entstanden und ins bewusststein und in die kultur der menschen eingeflossen sind. in vielen dingen kommen sie daher wie eine mittelprächtige cover-band von jesus christ superstar.

      • Das Freidenkertum hat seine Wurzeln in der Aufklärung, auch das organisierte. Aber wie alt ein «Club» ist, der sich für weltlich-humanistische Werte einsetzt, ist, ist doch völlig unerheblich. Die meisten unserer heute als selbstverständlich empfundenen Freiheitsrechte mussten erst dem Klerus abgerungen werden, es dauerte also, bis sich diese Ideen gegen die kirchliche Macht durchsetzen konnten. Davon aber hört man im Fach «Religion und Kultur» nichts.

      • fufi sagt:

        @ Andreas K.

        „Die meisten unserer heute als selbstverständlich empfundenen Freiheitsrechte mussten erst dem Klerus abgerungen werden“.
        Soll wahrscheinlich heissen:
        Früher erteilte der Priester die Absolution, heute der Freidenker?
        äxgüsi: Schwachsinn!

    • Robert sagt:

      Die „Freidenker“ sind keine Atheisten. Sie sind Agnostiker. Sie anerkennen, dass man einfach nicht sicher weiss, ob es Gott gibt oder nicht. Einige von Ihnen unterstellen, dass das eben eigentlich niemand wissen kann. Sie sagen „there is PROBABLY no god“.

      Und dann gibt es noch „die Freidenker“ als Vereinigung – und es gibt Leute, die ganz einfach frei denken.

      • fufi sagt:

        @Robert

        Wieso sagen sie, wenn sie’s denn eh nicht wissen können, nicht etwa: „there is probably a god“ – etwas tendenziös, wenn die „chancen“ 50:50 stehen, oder nöd?

    • Papi sagt:

      @ Andreas Kyriacou
      Wo man auch nichts von hört im Fach «Religion und Kultur», ist die tatsache das das Freidenkertum und die aufgeklärte Humanistisch werte hauptsächlich ihre Ursprung haben in der Erstürmung der Bastille (1789) and die anschliessende Französische Revolution.
      Ein jeder sollte aber wissen zu was diese Humanistische (Französische) Revolution geführt hat: Eine Schreckens-Herrschaft unter führung von Robespierre

      • Rocket sagt:

        @ Papi: Ihre Art zu argumentieren ist typisch für (religiöse) Dogmatiker: Man wähle sich aus, was gerade passt.

        Die frz. Rev. hatte auch selbstverständlich noch andere Folgen, z.B. die Formulierung der allgemeinen Menschenrechte. Dass dafür das Blut von macht- und geldgeilen Klerikern und Aristokraten floss nehme ich in Kauf und ich bedaure dass Unschuldige litten.

        Es floss auch ziemlich viel Blut, als man die amerikanischen Ureinwohner mit dem Christentum „beglückte“ und in einem biblischen Errettungswahn ganzen Völkern „das Wort Gottes“ brachte.

      • zysi sagt:

        @rocket

        a)

        Aussergewöhnliche Behauptungen erfordern aussergewöhnliche Belege. …
        ..der die Liebe als Emotion und ihre Konkretisierung in Handlungen bestritten hätte.

        ja diesem ersten satz mag ich insofern zustimmen, dass die aussergewöhnliche erscheinung gott (für sie als behauptung in der bibel aufgeführt) doch beachtliche, wenn nicht aussergewöhnliche belege zu tage brachte und bringt.
        ob man diese anerkennt oder nicht, hängt von verschiedenen faktoren ab. ich meine jedoch, dass „die geschichte“ der jüdisch-christlichen inhalte aus der bibel einen unvergleichlichen weg hinter sich haben, der sich auch in den errungenschaften zeigt. dies kann „gute“ wie auch „schlechte“ spuren beinhalten.

        eigentlich hilft dazu dann der schlusssatz; denn wir genau das gebot dieser (nächsten-)liebe beherzigen, dann handeln (lieben) wir doch auch entsprechen an/mit den mitmenschen, nicht?

        b)
        gut haben sie das religiös in (klammer) gesetzt im wissen, dass dort für ihren beitrag auch (humanistisch) stehen könnte?

      • Papi sagt:

        @ Rocket

        Ihre argumentation ist die gleiche wie die von Stalin und Mao und alle andere revolutionsführer: Um die revolution zu retten müssen die gegner der revolution ermordet werden.
        Es war in erste Linie nicht das Blut von Aristokraten und Klerikern das geflossen ist, sondern das von wenig extremen revoluzer und normalen Bürgern die nicht die gleiche Meinung waren wie Robespierre.

        Ich gebe zu: es ist natürlich schwer verdauerlich wenn man zugeben muss das Humanistische Werte basieren auf eine Schreckensherrschaft.
        Es ist noch tragischer zu sehen dass diese Schreckensherrschaft von Humanisten wegen ihre humanistische idealen auch noch gerechtfertigt wird.
        Aber es passt schon.
        Was besagt das 4. Angebot des evolutionären humanismus (Manifest des evolutionären Humanismus; eine Ansammlung von wirrköpfige Freidenkern)
        — 4. Du sollst nicht lügen, betrügen, stehlen, töten – es sei denn, es gibt im Notfall keine anderen Möglichkeiten, die Ideale der Humanität durchzusetzen! —

      • Papi sagt:

        @ Rocket

        Sie argumentieren wie jeder Revolutionsführer, ob Mao, Stalin usw: Um die Revolution zu retten müssen die anders denkende, die ide gegen die revolution sind ermordet werden,

        Während der Französische revolution wurde in erste linie nicht klerikern und aristokraten ermordet sondern, burger und mitstreiter der Revolution die nicht der gleiche Meinung waren wie Robespierre.
        Es ist natürlich schwer verdauerlich akzeptieren zu müssen das Humanistische Werte ihre Ursprung haben in einer Schreckensherrschaft.
        Es ist aber erschreckend zu lesen, dass diese herrschaft auch noch durch humanisten legitimiert wird.

        Aber es passt schon;
        Manifest des evolutionären Humanismus (Die Zehn Angebote des evolutionären Humanismus), Punkt 4 besagt:
        — 4. Du sollst nicht lügen, betrügen, stehlen, töten – es sei denn, es gibt im Notfall keine anderen Möglichkeiten, die Ideale der Humanität durchzusetzen! —

      • Rocket sagt:

        @Papi, und die Kirche war nie der Ansicht, dass die Gegner der Kirche bluten müssen? All die Hexen waren unachtsam mit dem Herdfeuer? All die Ketzer waren notorische Mörder und Betrüger und haben nur ihre gerechte Strafe erhalten. Ich weiss nicht was Sie mir sagen wollen. Machtverschiebungen gingen praktisch nie unblutig über die Bühne.

        Darf man sich Ihrer Meinung nach fragen, ob Machtverschiebungen hin zur Kirche blutig verlaufen dürfen, aber von ihr weg nicht?

      • Rocket sagt:

        zysi,

        a) Nein, ich sehe überhaupt keine Belege. Ich sehe ein ca. 2000 Jahre altes Buch, von dem grosse Teile aus allen Himmelsrichtungen abgeschrieben wurden, zu dem nacher noch x Teile hinzu- und wieder weg genommen wurden, nur dass sie ins jeweilige Weltbild passen. Das Wort Gottes wie es die Christen verstehen (und das sind ja auch höchstens 20% der Menschheit) ist in etwa so konsistent wie irgend ein anderes gesetzähnliches Dokument dass unter dieser Sonne verfasst wurde.

        Was bitte an den jüdisch-christlichen Inhalten der Bibel ist aussergewöhnlich. Haben Sie mal die Bagvahadgita oder Grundlage-Dokumente anderer Religionen gelesen? Haben Scientologen keine aussergewöhnliche Geschichten? Mit welchem Recht nehmen sie das Prädikat „aussergewöhnlich“ für diese spezifischen 2000 bis 6000 Jahre alten Geschichten in Anspruch?

        b) Das Gebot der Nächstenliebe… ach was, das gibts natürlich nur im jüd.-chr. Kulturraum. Ja wahrlich, wir haben Deutungshoheit, was lieb ist und was nicht, wir sind schliesslich die auserwählten. Hindus, Atheisten, Urwaldstämme die hölzerne Figürchen anbeten, die wissen alle nicht was Nächstenliebe ist.

      • zysi sagt:

        @rocket
        a) Nein, ich sehe überhaupt keine Belege. Ich sehe ein ca. 2000 Jahre altes Buch, von dem grosse Teile aus allen Himmelsrichtungen abgeschrieben wurden, zu dem nacher noch x Teile hinzu- und wieder weg genommen wurden, nur dass sie ins jeweilige Weltbild passen. Das Wort Gottes wie es die Christen verstehen (und das sind ja auch höchstens 20% der Menschheit) ist in etwa so konsistent wie irgend ein anderes gesetzähnliches Dokument dass unter dieser Sonne verfasst wurde.

        Was bitte an den jüdisch-christlichen Inhalten der Bibel ist aussergewöhnlich. Haben Sie mal die Bagvahadgita oder Grundlage-Dokumente anderer Religionen gelesen? Haben Scientologen keine aussergewöhnliche Geschichten? Mit welchem Recht nehmen sie das Prädikat “aussergewöhnlich” für diese spezifischen 2000 bis 6000 Jahre alten Geschichten in Anspruch?

        b) Das Gebot der Nächstenliebe… ach was, das gibts natürlich nur im jüd.-chr. Kulturraum. Ja wahrlich, wir haben Deutungshoheit, was lieb ist und was nicht, wir sind schliesslich die auserwählten. Hindus, Atheisten, Urwaldstämme die hölzerne Figürchen anbeten, die wissen alle nicht was Nächstenliebe ist.


        a)
        nein ich habe nicht alle grundlagendokumente aller möglichen „religionen“ gelesen – mit der bibel kann ich mich ausgiebig beschäftigen…und daher will ich hier auch keine bibelstunde abhalten.
        und, ich nehme mir das recht nicht hinaus, ich beobachte nur.

        b) sollten diese von ihnen erwähnten kulturen diese gleichwertige haltung auch enthalten umso besser; können sie mir auszugsweise einige quellentexte und -stellen nennen, da sie diese gut zu kennen scheinen? ich würde mich dann gerne schlau machen.
        was mir einzig aus pers. erfahrung bekannt ist, sind die nächstenliebenden kasten im hinduismus oder auch errungenschaften für die rechte der schwächeren unter den urwaldstämmen.

      • Rocket sagt:

        a)
        nein ich habe nicht alle grundlagendokumente aller möglichen “religionen” gelesen …, ich beobachte nur.

        In den Alpen stehen ein paar tausend Berge. Ich schaue den Eiger an und sage: „Der Eiger ist ein aussergewöhnlicher Berg“. Wenn Sie unter „beobachten“ ein Verhalten sehen, das Ihnen eine objektive(re) Weltsicht gibt, dann reicht eine Beobachtung nicht, dann bleibt es subjektiv, selbst wenn Sie bei Ihrer Beobachtung an dem einen Berg noch so objektiv vorgehen. Klar ist der Eiger ein aussergewöhnlicher Berg, wenn man sonst keine Berge anschaut/besteigt.

        b) sollten diese von ihnen erwähnten kulturen diese gleichwertige haltung auch enthalten umso besser; können sie mir

        Keine Notwendigkeit für den Konkunktiv II. Auch andere Religionen haben Wertekataloge wo nicht stehlen, nicht töten u. dgl. vorkommen. A priori anzunehmen dies sei nicht der Fall empfinde ich als anmassend.

        auszugsweise einige quellentexte und -stellen nennen, da sie diese gut zu kennen scheinen? ich würde mich dann gerne schlau machen.

        Leihen Sie in der Bibliothek ihrer Wahl z.B. die Bhagavadgita oder Kommentare dazu aus. Genau wie in der Bibel stehen dort Dinge, die man nicht grundsätzlich ablehnen würde, aber genau wie in der Bibel stehen auch Dinge drin, die eher fraglich erscheinen.

        was mir einzig aus pers. erfahrung bekannt ist, sind die nächstenliebenden kasten im hinduismus oder auch errungenschaften für die rechte der schwächeren unter den urwaldstämmen.

        Ich weiss nicht wieviele von all den Urwaldstämmen Sie wirklich kennen. Ich bezweifle dass alle gleich sind. Auch Christen haben Schwache aus ihrer Mitte verstossen (z.B. Siechenhäuser). Auch Kasten (bei uns hiessen sie Stände) gabs/gibts bei uns.

      • @Papi. Das ist so nicht richtig. Das «moderne» Freidenkertums – es hatte selbstredend seine Vorläufer in der Antike und es gab vergleichbare Parolen in allen Hochkulturen – fand nach gängiger Geschichtsschreibung seinen Anfang im Jahr 1600, dem Jahr, in dem Giordano Bruno der Inquisition zum Opfer fiel. Als Begriff etablierte sich «free-thinker» Ende des 17. Jahrhunderts in England.

    • Brunhild Steiner sagt:

      @Rocket:
      „Scheinbar haben mehrere Milliarden Menschen ähnliche spirituelle Erfahrungen mit komplett anderen (u. m.M.n. ebenso absurden) theologischen Konstrukten.“
      Nun ich kann mich nicht auf Milliarden berufen, aber doch auf einige Gespräche mit Menschen welche diese Erfahrung mit „komplett anderen absurden theologischen Konstrukten“ gemacht haben, zusätzlich sehr viele Lebensberichte, und diese Menschen sagen sehr wohl dass sie hier einen eklatanten qualitativen Unterschied feststellen konnten.
      Zum „das mal ausprobieren“ ermutigen mich diese Erlebnisberichte definitiv nicht,
      kann Ihnen also als Experiment nicht dienen… .

  • David Wiedemann sagt:

    Hmm – stellt Euch mal vor, es gäbe diesen Gott wirklich, und Euer Kind entdeckt ihn – was wollt Ihr denn da machen?
    Ich glaube an Gott – nicht weil mir das irgendwo gelernt worden wäre und nicht, weil jemand wollte, dass ich das mache.
    -> dass das nicht funktioniert sehen wir genauso in den Atheisten/Freidenker (Bin ich eigentlich nicht frei in meinen Gedanken, nur weil ich an Gott glaube? Hmm…), die in christlichem Elternhaus aufgewachsen sind, wie auch extreme, wie Leute, die scheinbar aus dem Nichts fundamentalistische, intolerante Leute werden, die nicht eine Gott, sondern ihre persönliche Idee eines solchen durch alle Böden hindurch der Gesellschaft aufzwingen möchten.
    Ich glaube an Gott, weil ich Ihn bereits als Kind erlebt habe und immer wieder neu persönlich in meinem Alltag erlebe!

    Zeigen wir lieber den Kindern in einem Schul-Unterricht, wieso unsere Gesetze nach wie vor auf den viele tausend Jahre alten 10 Geboten basieren, was denn Gott wirklich gemeint hat, wie wir laut Ihm in den Himmel kommen (nein, nicht die Taufe oder der Kirchgang oder die guten Taten machen aus mir einen geretteten Menschen – schon gar nicht, Geld zu zahlen), und dass einander lieben mehr ist, als ein wenig gute Gefühle zu entwickeln versuchen und dann hintendurch doch unehrlich und verlogen zu sein.

    Auch über andere Religionen sollen ruhig unterrichtet werden. Gerade weil die Religionen so einen grossen Einfluss auf dieser Welt haben, MÜSSEN die Kinder darüber Bescheid wissen. Und bei allem, was uns die Atheisten weismachen wollen: Es ist der Christliche Glaube (incl. allem unverstandenem Anwenden und missbrauchen), der unsere ganze Kultur prägt – ob wir das wollen oder nicht. Das nicht mehr zu unterrichten, nimmt letztendlich unserer ganzen Kultur und all unseren Werten die Wurzel!

    Soll Gott von der Schule fliegen? Das wäre ein weiterer Schritt zum langsamen und stetigen Untergang unserer Kultur – meine Meinung – und es macht auch gar nichts, wenn der Christliche Glaube in einem christlich geprägten Land bevorzugt gelehrt wird…

    • tobe or not tobe sagt:

      Die Kirche hat auch dir ein Bild des Glaubens verschafft, das du wohl nicht mehr loswirst..

      wer sagt das wir nicht gezüchtet wurden? Sind wir wirklich so arrogant zu behaupten, das nur wir ein Abbild seines Anliz sind?

      • Gianin May sagt:

        Es geht nciht um körper sondern um Geist. Unser Geist ist seinem ähnlich, denn wir kommen aus dem seinigen.

    • Da redet wieder mal einer von den zehn Geboten ohne sie zu kennen… «Du sollst keine anderen Götter haben», «Du sollst den Sababt heiligen», «Du sollst Dir kein Bildnis machen» – das sind alles Gebote, die sich ausschliesslich an die eigenen Religionsanhänger richten. Damit habe ich kein Problem, aber damit, dass Sektierer derlei freiheitsfeindliche Verhaltensvorschriften für allgemeingültig erklären wollen.

      • David Wiedemann sagt:

        Wenn Du damit kein Problem hast, dann ist es doch ok,, oder? Meine Aussage ging ging ja alleine dahin, dass unsere Grundwerte auf den 10 Geboten fussen:
        Du sollst nicht töten, nicht stehlen, nicht ehebrechen (wobei das ja in der Zwischenzeit überholt zu sein scheint – nur bei den jeweils direktbetroffenen dann plötzlich doch nicht mehr), Sabbat heiligen (Was ist unser Sonntag denn anderes? Oder jedenfalls dazu gedacht), nicht fluchen (lehren wir jedenfalls unsere Kinde), nicht lügen, und so weiter.

        Unser Rechts- resp. Unrechtsbewusstsein geht jedenfalls darauf zurüch, ob wir wollen oder nicht – meine Aussage…

        Doch, würde behaupten, kenne die zehn Gebote doch ein wenig 😀

      • Gianin May sagt:

        Du sollst nicht töten, Du sollst Vater und Mutter ehren – ja das allen aufzuzwingen ist schändlich.

      • @David Wintermann: Nein, eben nicht. Die religiösen Verteidigungsmauern, welche die ersten drei Gebote ausmachen, sind nicht Teil unseres Rechtsverständnisses – im Gegenteil. Der moderne Staat, in dem verschiedene Religionen um Mitglieder und Einfluss buhlen können sollen, hält die Religionsfreiheit hoch (inklusive der Freiheit, keiner Religion anzugehören!). Das Gebot «Du sollst keine anderen Götter haben» kann keine allgemeine Gültigkeit haben, es gilt nur für diejenigen, die sich aus religiösen Gründen dem Gebot verpflichtet fühlen.

    • Robert sagt:

      Solange Sie akzeptieren können, dass z.B. ICH eine völlig andere Meinung zu diesem Thema habe, habe ich auch mit Ihrer Einstellung kein Problem.

      Nehmen Sie bitte zur Kenntnis, dass es nicht die Atheisten sind, die namhaft zur Säkularisierung von Staat und Schule beigetragen haben, sondern die Agnostiker. Es gibt neben dem Spannungsfeld „es gibt einen Gott/ es gibt keinen Gott“ ein viel wichtigeres Spannungsfeld:

      Sie glauben an Gott, weil er Ihnen begegnet ist. Ich glaube nicht an Gott, weil er mir noch nie begegnet ist.

  • Marc sagt:

    Ich habe kein Problem mit einem !breit! gefächertem Religionsunterricht. Aber was mich stört ist wenn Gläubige(egal welcher Glaubensrichtung) versuchen mit einem über ihre Religion zu reden. Dies wirkt einfach schnell wie Missionieren oder ähnliches. Bitte lasst das!

  • mostindianer sagt:

    das fach religion und kultur sollte als das angesehen werden, was es ist: ein fach, in welchem es um die erweiterung des allgemeinwissens geht.
    man muss nämlich der radikalisierung, die in gewissen konfessionen (z.b. bei evangleischen freikirchen oder islamischen gruppen) herrscht, entgegenwirken durch wissen.
    wissen um andere ansichten, wissen um andere lebenseinstellungen. das erweitert die eigene lebenseinstellung, man kann vergleichen, etwas gut oder nicht gut finden, sich einen eigenen weg suchen.
    in diesem sinne könnte man das fach auch „lebenskunde“ nennen oder „mensch und umwelt“ (wie das fach „realien“ im kanton zürich heisst.

    • Das könnte man so stehen lassen – wenn dieser Aufruf, etwas über «die anderen» zu lernen, tatsächlich an alle gerichtet wäre. Dem ist aber nicht so. Religiös geprägte Kinder kriegen in diesem Fach keine Stunde Einführung in weltliche Ethik, sie müssen sich nicht damit auseinandersetzen, dass Kinder aus säkularen Haushalten gleichwertige Wertvorstellungen haben, dafür aber keinen religiösen Überbau benötigen.

      Damit ist das Fach faktisch Religionsunterricht alter Schule, ausser dass es neu über den beruflichen Werdegang der Kinder entscheidet, da es zum Selektionsfach geworden ist.

      • mostindianer sagt:

        „religion und kultur“ beinhaltet nicht nur die erweiterung des wissens über das christentum, sondern auch über den islam, buddhismus, hinduismus, atheismus, judentum etc. vielleicht sogar zu sekten. dass dieses fach mittels einer note im zeugnis dargestellt werden muss, darüber kann man sich streiten. das argument „notengebung wirkt sich auf die motivation aus“ hat hier wohl zu diesem entscheid geführt.

  • Johanna Toxo sagt:

    Wenn wir sind, was wir sind, ist es weniger dank der christlichen Wirkungsgeschichte sondern trotz der christlichen Wirkungsgeschichte. Die Errungenschaften unserer Kultur verdanken wir zu grossen Teilen den Griechen, Römern, Arabern, aber erstaunlicherweise auch den Chinesen und sonst noch vielen Kulturen. Das Aufkommen des Christentums hat (ähnlich wie heute der islamische Fundamentalismus in der arabischen Welt) den überlieferten Kulturreichtum unterdrückt. Das christliche Mittelalter ist ein schwarzes Tunnel in der europäischen Kulturgeschichte (zu vergleichen mit der Talibanbewegung). Die Kinder sollen nicht eine Religion verstehen lernen, sondern das Wesen von Religion, den kritischen Umgang damit. Ich halte mich für absolut religionsfrei und dennoch stehen in meinem Haus ein Koran, die Bhagavadgita, Schriften über Zen, I Ging und Voodoo. Wenn eines meiner Kinder mit so einem Buch im Zimmer verschwindet, freut es mich. Aussicht auf gute Diskussionen!

    • Robert sagt:

      Danke! Hier fühl ich mich aufgehoben.

      Nachdem ich hier (na ja fast) alle Kommentare durch habe, ist es das Bild, das diese Kommentare sozusagen repräsentativ von der „Welt da draussen“ ergeben. Es ist die Wahrnehmung dessen, wie Menschen mit dem Thema Religion umgehen, die mich arg daran zweifeln lassen, dass Kindern in der Schule wirklich etwas über „das Wesen von Religion“ beigebracht wird.

      Ist es nicht auch atypisch für ein Schulfach, wenn man darin unterrichten muss, dass man zwar eigentlich nichts sicher über das Thema weiss, sich aber die ganze Welt seit tausenden von Jahren deswegen bekriegt und streitet?

  • Maja sagt:

    Ich bin auch dafür, dass die Schule die Vielfalt der Religionen vermittelt. Das gehört zur Allgemeinbildung.
    Religionsunterricht habe ich besucht obwohl mein Elternhaus nicht religiös war.
    Zur Kirche bin ich ausgetreten drotzdem liebe ich die Adventszeit und Weihnachten. Im Grunde bewusster als vorher.
    Es ist die Zeit der Besinnung und „Freude herrscht“. Advent und Weihnachten beinhalten schon immer auch heidnische Bräuche. Keine Relligion kommt ohne diese aus. Für mich stimmt es so und das ist die Hauptsache.

    • Roger sagt:

      „Es ist die Zeit der Besinnung und “Freude herrscht”.

      Der Besinnung an was oder wen? Freude an was oder wen? Obwohl Weihnachten kein biblisches Fest ist wird die Geburt Christi gefeiert und nicht ein irgend etwas. Es geht um Jesus. Wem es nicht darum geht, der möge an Weihnachten bitte arbeiten gehen. Und an Ostern sowieso. Da geht es nämlich um die Auferstehung Jesu.

      • Globetrotterin sagt:

        @Roger:
        Weihnachten: das ist das Lichterfest. Da feiere ich, dass die Nächte kürzer und die Tage wieder länger werden.
        Ostern: Was haben Ostereier mit der Auferstehung Jesu zu tun? Sie können da ja feiern, was Sie wollen. Ich feiere auch, was ich will.

  • Piwoli sagt:

    „Leben aus dem Glauben“, das ist einer von acht Schwerpunkten der Jugendarbeit bei den Pfadfindern. Dies hat vor über 100 Jahren Baden Powell, der Gründer der Pfadfinderbewegung, so festgelegt, indem er sagte: „Ein Pfadfinder muss Glauben haben“.

    Wesentlich daran ist, dass er weder in seinen Worten, noch in seinen Taten, auch nur eine einzige Form des Glaubens ausgeschlossen hat, denn damit hat er erst ermöglicht, dass sich die Pfadfinderei rund um den Globus in tatsächlich allen Ländern der Welt ausbreiten konnte. Persönlich halte ich das für eine der bemerkenswertesten Leistungen des 20. Jahrhunders.

    Weitaus wichtiger jedoch ist es zu hinterfragen, warum er die Einbindung des Glaubens gefordert hat.

    Es geht dabei um die tiefe Einsicht, dass der Mensch letztlich nicht das Maß aller Dinge ist und somit um die Anerkennung einer höheren Macht. Die Anerkennung dieser Macht lehrt uns Demut, zuallererst jedoch Vertrauen. Vertrauen ohne Glauben gibt es nicht!

    Von Geburt an ist der Mensch auf der Suche, insbesondere auf der Suche nach dem Sinn des Lebens, dem Woher und dem Wohin. Hier bindet uns der Glaube ein in ein größeres Ganzes und schafft so einen Raum emotionaler Geborgenheit. Erst aus dieser Geborgenheit heraus kann der Einzelne sich entwickeln, reifen und wahrlich Mensch werden.

    Lebenskrisen – kleinere, größere oder auch existenzbedrohende – sind die Leiter der Menschwerdung. Kennzeichnendes Merkmal Letzterer ist es, in solchen Situationen völlig allein dazustehen. Völlig allein? Tatsächlich? Wer eine solche Krise bereits einmal durchleben musste, weiß, dass es einzig sein ganz persönlicher Glaube war, der ihn hindurchgeleitet hat.

    Damit möchte ich den Kreis schließen und zurückkommen auf den Religions-/Ethik-/Glaubensunterricht: Ich will mir nicht anmaßen, festzuschreiben, wie dieser Unterricht auszusehen hat, oder welcher Personenkreis den Unterricht halten soll, aber diesen Unterricht vom Lehrplan zu streichen, heißt nichts Anderes, als unsere Kinder ohne Leitlinie ins Leben zu schicken.

    • Andi Koch sagt:

      „…..Mensch letztlich nicht das Maß aller Dinge ist und somit um die Anerkennung einer höheren Macht.“

      Ist diese höhere Macht etwa unser Ebenbild bzw. umgekehrt?

      Der Mensch ist NATUERLICH nicht das Mass aller Dinge. Nur ist die logische Konsequenz daraus nicht, dass es eine höhere Macht gibt.

    • Robert sagt:

      Das „grössere Ganze“ als Gegenstand des Glaubens zu bezeichnen ist ein sehr guter Ansatz. Dies weil damit ein viel grösserer Raum von denkbaren Möglichkeiten offen gelassen wird für individuelle Weltbilder aus denen letztelich Geborgenheit geschöpft werden kann.

      Oder anders gesagt: Auch z.B. der Glaube an ein Universum, das auf reiner Zufälligkeit basiert und das dem entsprechend weder eine Ursache noch einen Sinn kennt, entspricht dem Glauben an ein grösseres Ganzes. Und aus einem solchen Glauben heraus müsste man die eignen Kinder davor bewahren, irgendeine fremde „Leitlinie“ verpasst zu bekommen sondern man müsste darauf achten, dass diese ihre Bedeutung in jedem Fall selbst finden können.

      • Robert, sehr schön, könnte ich als landeskirchlich organisierter Protestant sofort unterschreiben. Es gibt bei Paulus, der die Antike Philosophie ebenso kannte, wie seine jüdische Tradition im Kolosserbrief einen Christus-Hymnus, wo Christus zum „Kosmischen Christus“ aufgeblasen wird. „Christus“ wird zum „Symbol“ des „Grossen Ganzen“, das uns im Abendmahl sogar in den damaligen Biotechnologischen Hi-Tech-Nahrungsmitteln gegeben ist (Brot (hefe) und Wein (hefe)). Das Christentum ist also der grosse Bruch mit Religionen in denen Tiere für den Glauben leiden müssen. Vernünftiger kann man ein Religion für den Menschen gar nicht erfinden.

    • Evie sagt:

      Danke für diesen schönen Text. Selbst als Atheistin kann ich diese Meinung aus vollem Herzen unterstützen. 🙂

    • Baden-Powell ist ein sehr gutes Beispiel. Sein Motto „Treu Gott und dem Vaterland“ zeigt die doppelte Bindung: an die Gesetze der Rechtsgemeinschaft in der ich mich bewege (Vaterland) und an die religiöse Moral. Ein Pfadfinder, wird innerhalb der Rechtsordnung seines Staates immer aus seinem Glauben zu leben versuchen (was ihm auf einen Punkt gibt, von dem aus der Staat kritisiert werden kann) andererseits: wenn sein Staat einen „gerechten Krieg“ fürht, hat sich der Pfadfinder auch hier opferbereit einzureihen. Ein Intellektueller, der sehr stark aus dem „Treu Gott und dem Vaterlsnd“ lebt und argumentiert ist Adolf Muschg. Siehe: Heimat, o, mein Heimatland (1997).

  • Charles Brunner sagt:

    was heisst „christliche Werte“? Das Christentum besteht erst seit zweitausend Jahren, und wie alt ist die Welt? C.Brunner

    • „christliche Werte“ sind Werte, die durch lehre und Leben Christe „geoffenbart“ wurden. Es gab schon vor Christus Werte, das Gesetz Mosis, das auch auf dem Sinai „geoffenbart“ wurde. Die Werte bestanden aber als „vernünftige Sitten“ schon bei den Völkern, die nicht untergingen, wie „Sodom und Gomorrha“. Also „christliche Werte“ sind jene Werte die sich seit bestehen der Menschheit in unserem kultuirkreis als Lebenserhaltend und nachhaltig erwisen haben. Rein darwinistisch, historisch dargelegt. „christliche Werte“ sind ein ein Erfolgsmodell, darum schwätzen auch so viel von ihnen, mich eingeschlossen. „Allah“ hat andere Werte „geoffenbart“ in der Geschichte waren Reiche und Länder, die auf seine Werte bauten weniger erfolgreich. Seit 60 Jahren spielt Erdöl eine Rolle, aber Erdöl ist endlich.

      • adlerauge sagt:

        sehr einfache weltsicht inklusive.

        seit bestehen der menschheit… also etwa 4000 jahre?

      • Globetrotterin sagt:

        @GG:
        Einen solchen Unsinn zu verbreiten, sollte wirklich verboten werden, analog zum Holocaust-Leugnen.

      • Lena sagt:

        Quatsch. Es gab eine Zeit in der die islamische Welt erfolgreicher war als die Christliche. Christliche Gebiete fielen reihenweise in islamische Hände. Es gab sogar gewisse Gebiete im Balkan in denen die christlichen Untertanen teilweise sich freuten unter osmanische Herrschaft zu geraten, weil diese ihnen mehr Freiheiten liess als die vorherrige christliche Herrschaft. Viele Texte antiker Philosophen ect. überlebten in der islamischen Welt als die christliche Welt sie als ketzerisch brandmarkte und schafften es später wieder über diesen Umweg zurück in die westliche Welt. Die islamische Welt war wissenschaftlich auf einem höheren Niveau und kriegerisch mehr erfolgreich.
        Da du von Soddom und Gomorrha redest… damals existierte das Christentum noch nicht, aber das Judentum. Wobei man natürlich argumentieren kann, dass diese gewisse Werte mit dem Christentum teilen. Wobei aber dann dein Argument wieder nicht funktioniert, da die heidnischen Völker über Jahrtausende erfolgreicher waren als das Judentum. Abgesehen davon teilt der Islam genauso gewisse Grundlagen mit dem Christentum wie das Judentum. Jesus ist im Islam sogar ein Prophet, während er im Judentum nur ein falscher Prophet ist. Man könnte vielleicht sagen, dass der Islam für das Christentum ist, was das Christentum für das Judentum ist. Baut auf auf der Grundlage des anderen und sagt es ist ein neuer Prophet gekommen, der von der neuen Religion als wahr angesehen wird, vom anderen Teil, der bei der alten Religion bleibt aber als falscher Prophet.
        Christliche Werte existieren sowieso nicht als etwas allgemein gültiges. Der heutige Papst, der vor 500 Jahren und Petrus würden sehr unterschiedliche Antworten geben, geschweige denn ein protestantischer, anglikanischer, mormonischer ect. Pfarrer. Was als christliche Werte empfunden wird variiert abhängig von Zeit, Konfession, politische Ausrichtung, Land ect.

      • Marco Schilling sagt:

        Wie ginge es denn ihrer Meinung auf der Welt zu und her wenn es keine Religionen gaebe?

      • fufi sagt:

        @Adlerauge
        scharf gesehen!

        und deshalb @ Giorgio G.
        „Christliche“ Werte sind max 2000 Jahre alt.
        Wie alt die Menschheit sein soll, ist umstritten. Beginnt sie beim „homo erectus“ (ergo vor rund 1.9 Millionen Jahren)
        oder erst bei Giorgio Girardet (rund 1950 p.c.) – geht jedenfalls schon rein rechnerisch nicht wirklich auf.
        Und WAS ist „unser Kulturkreis“? Gehören da etwa Sizilien, Mazedonien und die West- und Südtürkei auch dazu?

        Und SIE nennen sich HISTORIKER!
        Und SIE meinen, Sie dürften einem Theologen an den Karren fahren ………. ?

        Ach ja, kennen Sie den Unterschied zwischen der Evolutonstheorie von Darwin und derjenigen von Lamarck?
        Und wissen Sie, was „survival of the fittest“ im darwinschen Sinn bedeutet? Jedenfalls NICHT dasselbe, was Sie im neoliberal-sozialdarwinistisch-apkalyptisch-christlichrassistischen Sinn darunter verstehen möchten.
        🙁

      • Widerspenstige sagt:

        @Lena

        Sehr gute Interpretation und historische Aufdeckung von (un)bequemen Wahrheiten über die Entstehungsgeschichte. Vielen Dank dafür und ich bitte Sie mehr darüber hier zu schreiben! Vorallem den abschliessenden Satz von Ihnen finde ich ganz wesentlich:

        ‚Was als christliche Werte empfunden wird variiert abhängig von Zeit, Konfession, politische Ausrichtung, Land ect.

    • zysi sagt:

      der andi koch kann ihnen sicherlich weiterhelfen. nachdem abschliessenden zählen im universum wird sich die kleine skala der zeitgeschichte in kürze zu ermessen sein…

  • Andi Koch sagt:

    Der Fall ist doch klar: Die Kirche sieht ihre Felle davon schwimmen. Hier gehts um Geld und Macht.

    Das Christentum ist ein wesentlicher Bestandteil der Europäischen Geschichte und kann im Geschichtsunterricht behandelt werden. Dort kann man auch schön auf die Koinzidenz dieser aus der griechischen Mythologie und des Jüdischen Monotheismus entstandenen Religionsvariante mit der maximalen Ausbreitung des Römischen Reiches eingehen. Die Kinder lernen, wie sich Religionen/Ideologien ausbreiten und zu monopolartigen Gebilden entwickeln. Eben, Geschichte.

    Ein moderner Ethik- und Kultur-Unterricht orientiert sich an den Wissenschaften und der Biologie des Menschen. Es ist erschreckend, wie ungebildet und ignorant viele Leute zu und gegenüber Fragen der Evolution und Neurobiologie sind. Auch könnte man in diesem Unterricht auf die Kultur der Wissenschaft und der Aufklärung eingehen. Man könnte richtig gute Philosophie mit den Kindern betreiben und sie die Fragen selbst erarbeiten lassen, was es denn z.B. in Bezug auf die Weltanschauung uns unser gesellschaftliches Verhalten mit sich bringt, wenn die Erkenntnis lautet, dass wir 97% des Genoms mit dem Schimpansen teilen oder dass sich eine Hefezelle für bestimmte Prozesse derselben Gene bedient wie der H. sapiens auch. Oder dass das uns bekannte Universum über 100 Mrd Galaxien à 100 Mrd Sonnen enthält. Oder dass sich Gedanken, Gefühle, Erinnerungen, Träume durch chemische Stoffe oder Traumata verändern/eliminieren/kreieren lassen, oder, oder…

    Täte man aber all dies anstelle eines Religionsunterrichtes und konfrontierte man die Kinder erst im Alter von 16 mit Religionen und Ideologien anderer Art, dann müsste man ein Kopfschütteln und Zurückweisen dieser Angebote vor dem Hintergrund des erlernten skeptischen Denkens und Philospohierens erwarten. Und damit sind wir wieder beim Punkt 1: Macht und Geld!

    • Jaja, Herr Koch, auch die Nazis orientierten sich eher an der „Wissenschaft“ und nicht an der verstaubten „christlichen Ethik“ einer „Sklavenethik“ wie Nietzsche ja feststellte. Darum kann man das Christentum historisch betrachten und in der Mathematik ökonomisch sachlich rechnen:

      Die Niere hat einen Marktwert von 5000 Fr. die Migrantenfamilie Z. verursacht dem Staat Integrationskosten von 10’000 Franken. Wessen Niere kann zur Begleichung dieser Kosten beitragen? Die des Vaters (Verdienstausfall durch Operation 1000 Franken) die der Mutter (Verdienstausfall 800 Franken, da nur Putzfrau) oder jene des arbeitslosen 19jährigen Sohnes?
      Argumentiere!

      Eine saubere Sache die philosophisch-ökonomische Ethik ohne christliches Gedöns.

      • Andi Koch sagt:

        Giorgio, Hitler war Katholik. Und an die äusserst fruchtbare Beziehung zwischen Vatikan und Berlin brauche ich Dich doch hoffentlich nicht zu erinnern? Und die SS Parolen zu Gott und Deutschland….
        Nazi-Deutschland hatte alle Formen einer Religion. Ein Besuch im modernen Museum des Reichsparteitag-Gebäudes in Nürnberg ist ein Besuch wert. Die Ausstellung zeigt sehr schön, wie eine Religion entsteht und wie man ihr Macht verleiht.
        Abgesehen davon: Wissenschaft sei Dank wissen wir, dass ethisches, also sozial bekömmliches Verhalten unabhängig von jeder Religion bzw. Nichtreligion ist.

      • Lieber Herr Girardet,

        mit dieser vollkommen unpassenden Antwort auf die nachvollziehbaren Ausführungen des Herrn Koch haben Sie die folgende Weisheit bestens bestätigt:

        „Der Geist eines Fanatikers ist wie die Pupille eines Auges. Je mehr Licht man hineinwirft, desdo mehr zieht sie sich zusammen“ – Oliver Wendell Holmes

        mfG
        Henning Kürsten

    • Globetrotterin sagt:

      Gott weiss alles, kann alles, sieht alles…nur Eines kann er offensichtlich nicht: mit Geld umgehen. Davon braucht er Unsummen, die wir alle gütigst spenden sollen (müssen).

      • tobe or not tobe sagt:

        Ich finde es bedenklich Kinder auf eine Religion einzuschwören, die Freie Wahl wurde ihnen somit versperrt.

        Doch die Kirche hat Angst ihre Schäfchen zu verlieren und vorallem Angst vor der grösserwertenden Islamischen Kirche!

        Menschen sind noch immer menschen und keine Halbgötter, egal welcher Religion angehörend..

        Die gezielte Steuerung unseres Bewusstseins durch Angst, panik und Teufelsgeschichten funktioniert noch immer.

        Wie bei Ying und Yang… Wo das gute ist, ist das schlecht nicht weit.. Gehört zusammen wie Pech und Schwefel!!!

        Man sollte den Kinder die menschlichen Abgründe näherbringen können, Abgründe die jeder Mensch an sich selber kennenlernen kann. ich nenen dies die eigene Dunkle Seite… doch viele flüchten vor sich selber und ihren eigenen teuflischen Gedanken wie Rache, Hass, Neid etc.. Wer das nicht realisiert, wird nie 1 mit sich selber sein..

      • Globetrotterin sagt:

        Bedenklich ist das vor allem, wenn es um Kinder geht. Get them while they’re young!

      • SiVoe sagt:

        😉 Nicht wirklich. Gott hat das Geld nicht nötig. Das ist ein erfundenes Ding der Menschen. Wer sich daran klammert, wird krank. Wer jedoch weise ist der gibt weiter, damit anderes wachsen kann.

      • tobe or not tobe sagt:

        Genau. Kinder sind reine Wesen.. Reine Seelen die bewusst verschmutzt werden und zu hassschürrenden Erwachsenen herangezogen werden, die heute erzählen das christliche Werte schon immer bestand hatten in dem Land…

        Lasst unsere Kinder in ruhe! Mein Forderung… Die Kirche ist ein Bund von satanisten, nix anders… Sie verführt, sie schürt hass, neid etc. und dies bei jedem. Unser Unterbewustsein wird nach dieser Hirnwäsche auch so denken und uns zum handeln zwingen..

      • Brunhild Steiner sagt:

        @to be or not to be:
        Einverstanden was die Prägung in der Kindheit betrifft, bloss, geprägt werden sie so oder so.
        Ist es nicht ein breites Band von „prägen“ bis zu „indokrinieren, Hirnwäsche und die Seele verschmutzen“?
        Und, gehen Sie auch mit demselben Eifer gegen andere, nicht weniger bedenkliche Prägungen aus der weiten Medien-und Konsumwelt vor, wo auch schon kleine Kinder auf bestimmte Verhaltensweisen fast schon „konditioniert“ werden?

        Es liegt an den Erwachsenen diese Prägung, aus welcher Ecke nun auch immer, so vorzunehemen dass nie eine Indoktrination stattfindet und sich das Kind auch davon lösen dürfte. Wenn aber diese Freiheit grundsätzlich zugestanden wird, sehe ich keine gröberen Probleme. Im Gegenteil, mit meinen Kindern erlebe ich Dimensionen welche ich nie für möglich gehalten hätte, sie kommen zu Schlussfolgerungen, Erkenntnissen, Wahrheiten welche ich nicht einfach vorgebetet haben, sondern welche sie sich, in Auseinandersetzung mit “Transzendenz” selber erarbeitet haben. Und die sich in ihrem Alltag, in unserem Leben ganz greifbar auswirken, fassbar sind.
        Hätte ich ihnen aber nicht von Anfang an das “Ausgangsmaterial” zur Verfügung gestellt,
        dann wären sie heute um viele Erfahrungen ärmer. Und ich übrigens auch.

      • Rocket sagt:

        Gott kann noch viele andere Dinge nicht, da muss man nur mal die Tagesschau sehen…

      • Gianin May sagt:

        Die Idee ist nicht verantwortlich dafür was der Mensch daraus macht….

      • Globetrotterin sagt:

        @Gianin May, 16.26:
        Diese Argumentation hatten wir doch schon bei „Killerargumente“. Da ist auch nicht die Waffe schuld, sondern der Mensch, der sie benutzt. Eine solche Argumentation ist einfach nur hahnebücherner Unsinn.

      • Orlando S. sagt:

        @Globetrottel: ja, ist am Ende die Waffe schuld und der Mensch unschuldig?

        Argumentation à la mode oberintellektuell, momol! Und es ist hanebüchener Unsinn, WEIL…(kommt da noch was?)

    • Robert sagt:

      Grundsätzlich stimme ich weitgehend mit Ihnen überein. Aber das Motiv „Geld und Macht“ alleine kann das volle Ausmass der Misere nicht erklären – höchstens gewisse Begleiterscheinungen davon.

      Offenbar ist ein – worauf auch immer bezogener – Glaube eines der tiefsten Motive aller Menschen. Nur so lassen sich all die Gräuel erklären, die AUCH im Namen des Glaubens seit Jahrtausenden verübt worden sind. Auch Bettelmönche sind z.B. äusserst stark motiviert.

      Man muss damit wohl in der Tiefe graben, um zu finden, womit dies zusammenhängt. Angst und das Bedürfnis nach Sicherheit vielleicht?

      • Gianin May sagt:

        @Rocket: Das könnten wir alles selbst tun, wenn wir nur wollten, wollen wir? Gott hat uns die Verantwortung für diese Welt übertragen, er will uns helfen, aber wenn wir nicht wollen …..

      • Gianin May sagt:

        Wenn Eltern religiös sind, dann wird bei der Erziehung von Indoktrin gesprochen – ganz allgemein ist es nicht möglich, dass ein religiöser Mensch Kinder zu selbstständigen Wesen erzieht – eine sehr intolerante und überhebliche Meinung – ev. Selbstüberschätzung. Umgekehrt wird selbstverständlich davon ausgegangen, dass die eigenen Kinder 100%ig selbst- und überhaupt kritisch sein werden und ganz bestimmt keinerlei falsche Voruteile/Intoleranz gegenüber Religion und religiösen Menschen haben werden – daher ist es auch nicht nötig, dass sie sich diese Kritikfähigkeit selbst erarbeiten müssen, sondern ohne Bedenken indokriert werden können….

  • tobe or not tobe sagt:

    Wissen Sie was mich an den Christen stört (war selber Katholik)?

    Sie trimmen unsere Kinder auf Nächstenliebe und und und…. Doch von der Nächstenliebe ist auch von der Kirche nichts zu spühren, die einzi nächsten die sie Lieben sind unsere Kinder, und das kann ich nicht akzeptieren.

    Gott? Wer ist Gott? Was ist Gott?

    Gott klingt so personifiziert… Ich glaube das Gott, die Mutter Erde das Universum darstellt und keine menschliche Person ist!!

    Wir Menschen sind zu arrogant, so arrogant das wir glauben das Gott ein menschliches Anliz hat.

    Die Kirche verarscht uns seit Jahrhunderten und denen soll ich noch Geld geben? Geld, das in Augen ihres Jesus nur übel über die Welt brachte.

    Jesus, wird auch als Isa im Koran erwähnt, als ein weiterer Prophet. Aber Sohn Gottes? Jeder von uns wäre ein Sohn oder Tochter Gottes mit den gleichen Fähigkeiten wie er es gehabt haben soll.

    Religion hat in der Politik wie auch im Alltag nichts zu suchen, denn es gibt zusammgenfasst für jeden Menschen seine eigene Religion, also bzw. 7 Milliarden Glaubensrichtungen..

    • Gianin May sagt:

      Ja uns je mehr solche Individualgläubigen es gibt umso besser wird die Welt… hää?

      • tobe or not tobe sagt:

        Umso mehr Leute realisieren, das sie nieamnd von ihrem Glauben überzeugen müssen oder sollen, umso mehr ruhe kehrt heim

        Religionen werden heute überschätzt!! Der Mensch hat die Weisheit vor sich, will sie nur nicht sehen..

  • Philipp Mahrer sagt:

    Warum so viel Angst vor der Bibel? Und warum wird Kirche mit Bibel gleichgesetzt? Ich habe früher auch alles Christliche kritisiert bis ich verstanden dass a) die Schweiz da ist wo sie ist wegen diesen christlichen Werten und b) die Bibel die Antwort auf ALLES ist und dass Probleme oft geistigen Ursprungs sind (alle haben wir einen Körper, einen Geist, eine Seele. Siehe 1 Tesalonicenses 5:23). Nun, dann habe ich nach einer Zeit Jesus als meinen Retter akzeptiert (Römer 10:9) und die Dinge haben sich innerhalb von 2 Jahren RADIKAL zum Besseren geändert: bin ausgewogen geworden und fühle Frieden in meinem Herzen. Ah, nein nicht Yoga, nicht Reiki oder sonstwas, nur Jesus führt Sie zum Heil: Johannes 14:6. Noch einmal, ich rede hier nicht von der Kirche, sondern vom Evangelium, warum nehmen Sie nicht Mal Ihre verstaubte Schulbibel hervor und beginnen das Johannes Evangelium zu lesen und im Stillen zu Jesus zu beten (ganz normal reden, ohne Formeln und Flosskeln, als ob Sie mit jemandem hier auf Erden reden würden? Und sollten Sie ein Problem haben weil Sie Jesus nicht sehen können dann hilft vielleicht dies: Hebräer 11:1. Gottes Segen und viel Spass auf Ihrem neuen und auf jeden Fall viel besseren Weg. Übrigens: Ängste, Süchte, Geld… von alldem redet die Bibel und unser Gott ist kein strafender sondern ein liebender Gott, immer noch Angst?

    • Robert sagt:

      Eben: Wegen Leuten wie Ihnen habe ich persönlich arge Bedenken bezüglich der Bibel und der Kirche.

    • tobe or not tobe sagt:

      Einbildung ist die Plazebopille des Glaubens.. und sie wirkt da geb ich ihnen recht…

      Jesus mein Erlöser? Wo ist er denn?

      Der Grundsatz des christlichen Glaubens ist menschenfreundlich und wäre richtig gelebt, eine Religion bzw. Einstellund die Liebe verbreitet und keinen Hass gegenüber andersgläubigen schürrt….

      Und noch eins. Die Schweiz wurde auch christianisiert…Gemischt mit Keltischen Bräuchen, wurde das heutige Bild der Kirche erschaffen!

    • Hans Mustermann sagt:

      Ja die Bibel. Steht da nicht auch was von Auge um Auge etc?
      Also ich würde so ein Buch ja auf den Index setzten wegen seinen vielen Gewalltdarstellungen und Aufrufe gegen Andersdenkende vorzugehen. Ausserdem ist die Auslegungen (das darf man nicht wörtlich nehmen, das must du so sehen) einfach lächerlich..

      • Lieber Hans Mustermann, oben hat ein etwas Christustrunkener Zeitgenosse mit Bibelstellen um sich geworfen. ich habe die Bibel noch nicht ganz gelesen, könnten Sie mir eine Zusammenstellung von Büchern und Kapiteln zukommen lassen, die ich bei der Lektüre meiden soll? Kant meinte noch, die lektüre Bibel sei geeignet, ein besserer Mensch zu werden. Sie leben heute, und haben natürlich ein Wissen, dass 200 Jahre „aufgeklärter“ ist. Könnten Sie zuhanden der Mamablog-Leserinnen und Leser so ein Liste von „unstittlichen“ oder „verwerflichen“ Stellen zusammenstellen, damit wir sie nicht ahnungslos lesen und Schaden nehmen, oder gar zu gefährlichen, kriminellen Menschen werden?

      • fufi sagt:

        @H.M.
        Aug um Aug: Das war damals – so vor rund 3000 Jahren – eine echt revolutionäre Idee: Weshalb töten und später – nach dem System Blutrache – zurücktöten und wieder töten?
        Nee, war ein erster Versuch zur Eindämmung von Lynch-Justiz und Etablierung eines Rechtssystems, das auf auf einer Vorform von „Wiedergutmachung“ aufbaute.
        Aber wie gesagt, war vor 3000 Jahren. Ist als Rechtssystem heute vielleicht zumindest diskutabel?

      • Hans Mustermann sagt:

        @fufi
        Genau darum ist für mich die Bibel ja ungeegnet um heutzutage eine Moralvorstelung aufzubauen.
        Ausser man macht es wie Philipp Mahrer und sucht sich raus was einem gerade gefällt.
        Das ausrotten der Sünde bzw. der sündigen Menschen duch einäschern mehrerer Städte war zweifellos auch eine revolutionäre Idee. Aber ist sie darum auch eine gute?

      • fufi sagt:

        @H.M.
        Nein, glaube nicht dass die Bibel zum Aufbau heutiger Moralvorstellungen ungeeignet sein sollte.
        Meine bloss, dass wir Vorstellungen von so etwa vor 2000 – 3000 Jahren nicht einfach unbesehen übernehmen sollten, sondern vielleicht zwischendurch Hirn – jaja, und Herz – einschalten sollten!
        😀

  • Christoph sagt:

    Kleiner Nachtrag

    In diesem konkreten Fall würde ich auch wagen zu behaupten, sein Beten hatte sehr pragmatische Gründe. In der Not frisst der Teufel fliegen 🙂

  • stef sagt:

    Was hier immer Christliche Werte genannt wird, sind die Werte der Aufklärung. OK, Jesus, falls es ihn gab, war sympatisch, viele gute Ideen. Aber das Christentum besteht nicht nur aus der Bergpredigt, sondern auch aus dem alten Testament mit allen mörderischen Geschichten, den Kreuzzügen, der Unterdrückung der Frauen, Homosexuellen, anders Gläubigen, etc. Luthers Aussagen über die Bauernaufstände, der Unfehlbarkeit des Papstes, Judenverfolgung, der Unterstützung von Diktaturen,…
    Unsere Werte wurden erkämpft, ich bekam im Mamablog deswegen schon mal aufs Dach, aber ich bleibe dabei, wenn in der Schweiz die Jesuiten nicht ne Zeitlang verboten gewesen wären, hätten wir es nicht so schön wie wir es jetzt haben.
    Unterricht über Religionen in der Schule ok, dann aber nicht von den Religionslehrern, diese aben eine andere Aufgabe, die nicht mehr in der Schule wahrgenommen werden soll.
    Ich habe in den Religionsstunden noch gelernt, dass die Menschen nicht durch die Evolution entstanden seien und die Wahrheit bei den Kreationnisten läge.
    Ich hoffe, dass die Kinder in der Schule das Hinterfragen üben, nicht Dogmas lernen.

    • the man sagt:

      Ich kann dir versichern, moderne TheologInnen sind etwas weiter als es deine Religionslehrer anscheinend waren, vorallem Jesuiten würden dich überraschen! Warum zählst du eigneltich nur die Entgleisungen des Christentums auf? Unterdrückung der Frauen, Homosexuellen usw. gab und gibt es auch in „aufgeklärten“, säkularen Staaten. Auf was für Werte beriefen sich die Aufklärer denn? Die universellen Menschenrechte wurden vom Naturrecht abgeleitet, das massgeblich durch Thomas von Aquin geprägt wurde.

      • Stef sagt:

        Ja, ich kenne tolle Pfarrer, ja es stimmt, die Christen haben nicht alles Übel der Welt für sich gepachtet. aber es ändert nichts daran, das übel gehört dazu, die positiven Veränderungen wurden auch erzwungen. ethik kann nicht unterichtet werden, die muss gelebt werden. Die Aufklärer gibt es nicht, also haben sie auch keine einheitliche Ethik. was in der Schule gelernt werden soll, ist die Wissenschaftliche Herangehensweise, damit die Kinder eigene Erkenntnisse machen können.

    • Gianin May sagt:

      Die Unterdrückung der Frau im AT, ist unsere Ansicht und Interpretation, das muss weder so gewesen noch so empfunden worden sein.

  • Tamar von Siebental sagt:

    Bei uns ist hat man den Religionsunterricht folgendermassen organisiert: von der 2.-4. Klasse werden die katholischen und protestantischen Kinder getrennt in Randstunden unterrichtet, die Kinder anderer Religionen haben dann frei. Ab der 5. Klasse gibt es dann den ökumnesichen Unterricht, welcher für die Katholiken und Protestanten obligatorisch und für die Schüler anderer Glaubensrichtungen freiwillig ist. Dieser Unterricht findet ebenfall in Randstunden statt, die anderen haben dann frei.

    Ich finde, dass dies eine gute Lösung ist.

    • Allwis Sender sagt:

      Frau von Siebental, genau das ist die absolut schlimmste Lektion, die die Kinder dabei lernen – nämlich:“Wir sind verschieden! Wir gehören nicht zueinander!“, Die Katholiken und die Protestanten gehen in den getrennten Unterricht aber alle Anderen haben da bei „uns“ nichts zu suchen.
      Wahrlich eine Lektion, die verstanden wird, wie sowohl gut aus den Kommentaren zu den entsprechenden Artikeln in der Tagespresse, als auch im Ergebnis der Abstimmung über die Minarettinitiative zu erkennen ist.

      • Orlando S. sagt:

        Sind wir denn nicht verschieden? Dafinieren wir uns nicht dadurch als Indiiduen, dass wir uns auch von anderen unterscheiden und auch abgrenzen? Sollten wir zueinandergezwungen werden, indem wir so tun, dass wir nichts glauben, keine Identitäten haben, keine Kultur, alles United Colors of Benetton, MTV/McDonalds?

      • Orlando S. sagt:

        zugegeben, Benetton und MTV war jetzt sehr 90ies von mir…
        🙂

      • Tamar von Siebental sagt:

        @ Allwis Sender

        Ich bin anders, Du auch? Kennen Sie diesen Spruch?

        Nehmen Sie sich diesen zu herzen. Jeder ist anders und jeder soll so akzeptiert werden wie er ist, solange er nicht irgnedwie gewalttätig ist oder so.

        Bei uns werden die Religionsstunden von den Kirchen orgnisiert, den anderern Kirchen steht es doch frei, ihren Schäfchen ebenfalls etwas anzubieten, es ist nicht meine Schuld, wenn diese zu faul sind dafür. Die Mitglieder der Landeskirchen sind dagegen grosszügig, weil sie andere auch daran teilhaben lassen ohne dass diese Kirchensteuer bezahlen müssen.

        Ich möchte nicht, dass meine Kinder gleich sind wie die anderen, dann könnte ich mir nämlich ebensogut einen Roboter anschaffen.

    • Katharina sagt:

      Wieso ist oekumenischer unterricht obligatorsich? das macht keinen sinn. orthodoxe calvinisten muessten da sofort auf die barrikaden! aber subito.

  • Christoph sagt:

    Ist doch ein Teil der Entwicklung. Ich ertappe mich auch heute mit 34 wie ich überlege, ob ich vielleicht nicht doch mal in die Kirche gehen sollte. Einfach mal schauen wie das so ist. Kinder wie auch Erwachsene sollten lernen, wie man DIngen im Leben begegnet. Nicht was sie dann denken sollen.

    Obwohl Atheist, kann ich einem gesunden Glauben eigentlich nur Gutes abgewinnen, egal welcher Richtung. Und wenn nicht, auch gut.

    Wer mir beibrachte, ich solle im Zweifelsfall für die Schwachen sein, ist schlussendlich egal. Sozialistischer Vater oder evangelischer Dorfpfarrer, beide hätten sie recht.

    • Robert sagt:

      Ja, aber letztlich sind sie eigentlich sehr inkonsequent. Sie definieren ja „gesunden Glauben“ schon so, dass dieser sich mit ihrem persönlichen Weltbild verträgt.

      So gesehen empfehle ich ihnen SEHR mal wieder in die Kirche zu gehen und der Predigt zu lauschen. Einfach damit sie überhaupt mitbekommen, was da so gesagt und vermittelt wird. Um ihr Verständnis von „gesundem Glauben“ etwas zu untermauern sozusagen…

      • Christoph sagt:

        Konsequenz ist doch ein alter Hut, möchte ich gar nicht. Jeder bewegt seine Meinung im Laufe des Lebens.

        Und mein persönliches Weltbild ist das nicht. Sich für Schwächere einzusetzen, da sehe ich keine grosse Ethik oder Philosophie dahinter. Eher eine Selbstverständlichkeit.

        Und ich gehe zuletzt in die Kirche, um der Predigt zu lauschen. Das ist für mich genau der negative Punkt. Was soll mir ein gleichaltriger Pfarrer denn erzählen?

        Zusammengefasst: Kirche nein, Glauben ja.

  • Simon Leighton sagt:

    Zu meiner Zeit gab es gleich nach dem Religionsunterricht die Naturkunde-Stunde. Da wurde dann erklärt, dass der Homo Sapiens ein Nachfahre des Neanderthalers ist. Sichtlich verwirrt ob dem Wirrwarr in unseren Köpfern fragten wir die Lehrerin, wer denn jetzt unser tatsächliche Vorfahre ist? Adam & Eva wie im Religionsunterricht erfahren oder doch der primitive Neanderthaler!?
    Leider bekam ich bis zum heutigen Tag keine nennenswerte Antwort. Zum Glück…!
    Religion zu unterrichten ist bestimmt nicht abwegig aber dann sollten alle Religion erwähnt und ausgeleuchtet werden und nicht nur auf die Bibel bzw. Christentum eingegangen werden.
    Es reicht schon vollkommen aus, dass wer zur Welt kommt das menschliche Freiheitsrecht parallel zum kappen der Nabeschnur verliert und in eine Glaubenschublade gesteckt werden soll. Jedes Individuum ist diesbezüglich in seiner Freiheit beschnitten worden…

  • Orlando S. sagt:

    Guter Text mit der nötigen Delikatesse und Seriosität, Frau Binswanger!

    Ich bin im Prinzip mit Roberto Lasso 08.32 einverstanden – aber eben nur im Prinzip: „Wir haben es mit der Säkularisierung weit gebracht und sind damit gut gefahren. Der Gottesglaube wird durch Prägung eingeimpft und ist Sache der Eltern und nicht des Staates. “

    Und auch hier kann man wiedermal vom gottlos-materialistischen/ultrareligiösen (zutreffendes bitte unterstreichen) Amerika lernen. Dort werden Sie nie einen Streit um Kreuze in Schulzimmern oder Kopftüchertragen finden. In der Schule wird auf die Fahne geschwört, jedenfalls in den Red States. Und Sonntags gehen die Kinder zur Sonntagsschule nach Wahl, während die Eltern vor dem Football-Game noch schnell ihre Ration Community und Religion abholen und einen Haufen Geld spenden.

    Das ist gelebter Individualismus, bei uns will man immer alle über den gleichen Kamm schären und zwingt dann ganze Schulklassen z.B. in die „Körperwelten“-Ausstellung dieses widerlichen Nihilisten, dessen Name mir entfallen ist.
    Alle im Gleich(macher)schritt und Gänsemarsch, eins, zwei. Fernbleiben nur in begründeten Ausnahmefällen und mit ärztlichem Attest per Antrag 14 Tage im Voraus (Poststempel!)!

    Hier im alten Europa in der Schule Kultur lehren und gleichzeitig das Christentum ausklammern zu wollen dünkt mich dann aber doch eine ungesunde Verrenkung, hat auch etwas zwanghaftes: die wahren Zeloten scheinen mir da die „Freidenker“ und fanatischen Atheisten zu sein.

    Aber eben, die Diskussion ist die alte, was die Schule nicht alles zu vermitteln hat…

  • Auguste sagt:

    hmm…, warum fühle ich mich unter Freidenkern und Freikirchlern am wenigsten frei mit meinem Glauben oder meinen Zweifeln?

    youtube: joan osborne – one of us

    • rosi sagt:

      Vielleicht, weil diese Sie mit ihrem Glauben, äh, Nicht-Glauben, missionieren wollen?

    • Robert sagt:

      Wenn Sie schon Freidenker und Freikirchler in einem Atemzug erwähnen, können Sie gleich die Freisinnigen mit einschliessen.

      Sich zwecks Wahrnehmung der eigenen Interessen zu gruppieren ist schon im Grundsatz etwas, das der Freiheit widerspricht – was bei der wohlmeinenden Gründung zwar erst einem unvermeidbaren Kompromis entspricht. Dann passiert aber, das jedwelche Gruppe unweigerlich die entsprechenden Fundamentalisten anzieht und realistischerweise auch einverleibt – was im Fall von Freiheitlichkeit zwangsweise nur in die falsche Richtung gehen kann, denn Fundamentalismus muss von Freiheit anerkannt werden, während Freiheit von Fundamentalismus nicht anerkannt werden darf.

      • Auguste sagt:

        hmm…, robert, unlängst wurde in freysinger’s blog hier google, wikipedia usw. etwas verteufelt. solange man im internet auf voten wie ihres stossen kann, scheint mir das noch ungerechtfertigter als vorher.

  • lamakki sagt:

    Als Agnostikerin, Freidenkermitglied und R&K-Lehrerin muss ich sagen: Es ist eine gute Sache. Wir sind auf dem richtigen Weg. Toleranz und Aufklaerung muss unbedingt gefoerdert werden. Was dann jeder einzelne glaubt, bleibt ihm ueberlassen und ist nicht Aufgabe der Schule und auch nicht der Eltern.

    • Als „Agnostikerin, Freidenkermitglied und R&K-Lehrerin“, Wow, sie liegen voll im Trend. Als Frau ist es ihnen gelungen eine Nische in der Bildungsverwaltung zu besetzen mit der gerade herrschenden Ideologie, die sich natürlich in Paragraphen ausgemünzt hat und sie nun ins Brot setzt. Und sie sind auch voll zufrieden: „Wir sind auf dem richtigen Weg.“. So sprach Lenin 1919 auch und auch Robespierre 1792. Nur Calvin starb 1564 verbittert, weil er nichts erreicht hatte. Nur Moses starb unerlöst, weil er das „gelobte Land“ nicht betreten durfte. Sie unterrichten „Religion und Kultur“. Wenn Sie den nächsten Monatslohn beziehen, lassen sie sich eine Tausendernote aushändigen und studieren Sie sie mal genau. Lernen Sie von unserem „kostbarsten“ Denker, dass „Religion“ und „Kultur“ zwei unterschiedliche „Potenzen“ sind. Nun werden sie als Frau einen klaren Begriff der „Potenz“ haben. Aber es müsste Sie doch beunruhigen, dass sie in ihrem „Schulfach“ nun zwei so verschiedene „Potenzen“ wie „Religion“ und „Kultur“ zusammen unterrichten. Können Sie das wirklich? Oder sind sie einer wohlfeilen Lebenslüge aufgesessen?

    • Orlando S. sagt:

      @lamakki

      Wie passt das zusammen „Agnostkerin, Freidenkermitglied“ und RELIGION- und Kulturlehrerin? Sie sind ja Partei! Wie würden wir aufschreien wenn sie geschrieben hätten: „Laienpredigerin bei Vineyard, Bibelgruppenmitglied und R&K-Lehrerin“?

      Und weiter: „Was dann jeder einzelne glaubt, bleibt ihm ueberlassen und ist nicht Aufgabe der Schule und auch nicht der Eltern“

      Wozu braucht es also dieses Fach?

  • Olivier Leuenberger sagt:

    Unsere Kultur ist klar christlich geprägt, ob wir das nun wollen oder nicht.

    Es geht darum aufzuzeigen was und warum unsere Kultur ist, wobei eben auch das Christentum eine Rolle spielt. Auch als Atheist kann ich das sehen/nachvollziehen. Ausserdem möchte ich nicht, dass ein Religionsvakuum implementiert wird, dieses soll sich eher natürlich über einen längeren Zeitraum entwickeln.

    • Genau. Ein Religionsvakuum bleibt nicht lange bestehen. Der männliche Mensch hat ein Bedürfnis in Horden zu brüllen und das findet immer wieder eine Götzen. Wenn sich die Kirchen leeren, dann füllen sich die Stadien und Religionslehrer und Soziologen schrieben über Fussball und Sepp Blatter, oberster Vertreter „of the game“ auf Erden hält im irdischen Zürich Einzug und lässt sich den fetten Ring küssen.

      • Auguste sagt:

        hmm…, gott liebt den fussball – maradona’s hand würde das, ohne mit der wimper zu zucken, bestätigen.

      • Logine sagt:

        Wen meinten Sie da genau mit dem „männlichen Mensch“? Und die „weiblichen Menschen“??
        Ich wäre jetzt aber doch nicht ganz soweit gegangen, meine religiösen Mitmenschen als brüllende Horde oder Götzendiener zu bezeichnen…. Vielleicht ist es ja eher ein urmenschliches Bedürfnis dazuzugehören. Nicht nur Religion, auch die Fussballpassion wird ja nicht zuletzt in der Familie vorgelebt, statt Heiligenbilder kauft der Onkel dem Bub halt Panini-Sticker….

      • @Logine

        Als Opfer des feministischen Diskurses sage ich: über den „weiblichen Menschen“ masse ich mich keine Aussage zu. Der weibliche Mench scheint mir in der Regel sein Glück darin zu finden, was auch immer der „männliche Mensch“ denkt und sagt eine stille Überlegenheit in seinem Herzen zu festzustellen: ob er nun an Gott glaubt, oder Paninini Bilder sammelt: Sie kann darüber nur lächeln. Nicht wahr Logine? Lächeln Sie mich aus!

      • Abgesehen davon, Auguste, dass Maradonas Hand wohl keine Wimpern aufweist…

    • Aloho sagt:

      Oder unsere Kultur hat das Christentum geprägt. All‘ die Feiertage bestanden schon vor dem Christentum, wurden einfach mit Christlichen Namen überdeckt (Oster = Fruchtbarkeitsfest, Weihnachten = Wintersonnenwende).

    • Katharina sagt:

      unsere Kultur ist klar christlich geprägt das stimmt einfach nicht.

      die Römer etwa brachten die Grundlagen eines Rechtssystems. wohl auch Grundlagen einer staatlichen Organisation.
      dann die Griechen.
      die Juden
      die Mauren

      nehmen wir die Mittelmeer-Region als wiege Europas, dann ist ja die südliche Hälfte…arabisch, ooopsie.

      deren spuren gibt es an vielen orten europäischen Kulturerbes.
      Mathematik etwa. Zeitrechnung.
      Architektur nicht vergessen.

      Aber dann ganz sicher nicht, ja wo würden wir denn da hinkommen ja neisi, naemet sie de leisi….

  • Cara Mia sagt:

    Nun, Gottglaube gehört zu unserer Kultur, die Kinder kriegen ja täglich Kirchengebimmel und so weiter mit, feiern Ostern und Weihnachten. Also muss man ihnen auch erklären, was es damit für eine Bewandtnis hat. Es gehört zur Allgemeinbildung, die verschiedenen Religionen und Theorien zu kennen, ebenso die Gefahren, die von Fundamentalismus und Frömmlerei ausgehen.

  • Martin Rüedi sagt:

    Es gibt nicht einen positiven Grundsatz des Humanismus, der nicht von Jesus Christus gepredigt wurde. Noch krasser ist es bei der Ethik.

    Nur Humanismus und Ethik zu fordern bedeutet also eine Reduktion und Abschwächung, vom dem was alleine Jesus Christus vermittelte…

    • Evil Ernie sagt:

      das grundsätzliche Problem der Gläubigen ist auch immer der IRRglaube.
      Wenn Sie ihre Aussage genau umdrehen kommen sie der Wahrheit ein ganzes Stück näher. So müsste es heißen:
      Es gibt nicht einen positiven Grundsatz von Jesus Christus, falls es ihn gab, der nicht schon lange vor ihm durch den Humanismus z.B. von irgendwelchen “alten Griechen” definiert wurde.
      Nachhilfe in Geschichte gibts z.B. mit dem Suchbegriff “Humanismus” bei Wikipedia.

      • Martin Rüedi sagt:

        Es geht nicht um die Reihenfolge. Sondern um Inhalte. Inhaltlich schlagen die Aussagen von Jesus Christus alles was vor ihm und nach ihm zu diesem Thema gesagt wurde. Bitte selber mal nachlesen!

        Ich fordere jeden heraus, irgend eine lebende oder tote Person aufzuzählen, deren gelebte Menschenliebe mit derjenigen von Christus mithalten kann – und – die nicht nach eigenen Aussagen primär von Jesus Christus geprägt wird oder wurde.

        Dies ist darum relevant, weil es selbst für einen reinen Ethik- und Humanismus-Unterricht nichts besseres gibt als Jesus Christus zu lehren. Auch in einem Schulfach. Warum die Kopie, wenn das Original so tauglich ist?

        (Und im übrigen spricht auch Wikipedia nicht von Humanismus im engeren Sinne bei allem was vor dem 15. Jh geschah).

  • Barbara sagt:

    Wie kann man sich für oder gegen etwas entscheiden ohne die Grundzüge zu kennen?
    In dem Fach geht es doch auch darum Vorurteile und Nichtwissen verschiedener Religionen vorzubeugen. Kritisches denken setzt Wissen voraus.
    Christ sein bedeutet übrigens nicht, pädophile Priester zu befürworten, oder die Kreuzzüge als gutes historisches Ereignis zu sehen. In der Vergangenheit wurde nicht nur im Namen der christlichne Kirche unmenschliches begangen. Und wenn in der Schweiz nur Atheisten leben, oder Leute denen der Glaube ohnehin egal ist, wer hat dann gegen die Minarette gestimmt?

    • Rocket sagt:

      Wie konnten Sie sich gegen den Zoroastrismus (monoth. Religion, entstanden ca. 1000 v. Chr.) entscheiden, ohne seine Grundzüge zu kennen?
      Ich habe als agnostische Atheist gegen Minarette gestimmt, wie ich gegen Kirchensteuern f. Unternehmen gestimmt habe und auch gegen Kirchtürme und anderes religiöses Gehütt stimmen würde (beso. wenn Sie so indiskret ins Landschaftsbild eingreiffen wie KT und Min.).

  • Manfred Meier sagt:

    Also ich lese die Geschichte ganz anders, religionsfrei sozusagen:
    Herr Binswanger jun. verteilt die mühsameren Jobs and Schwester und Mutter und tut selber etwas, das nichts kostet, nichts bringt, aber irgendwie wichtig tönt. Der junge Mann hat das Zeug zum Topmanager, chapeau!

  • zysi sagt:

    An einem verschneiten Nachmittag zwischen Weihnachten und Neujahr verbringen wir die gemeinsame Zeit als Familie mit Spielen, Malen und warmen Tee mit Güezi; einfach schön bieder.

    Unsere Kinder freuen sich schon auf das bevorstehende Cheminéefeuer, wenn’s dann dunkel wird, und der kleine Bueb möchte am liebsten schon jetzt mit dem Zündholz fuchtelnd starten….

    Plötzlich klingelts an der Türe und die Nachbars-Mama aus der unteren Wohnung steht mit ohnmächtigen Gesicht vor der Türe und ihrem Wh.gschlüssel in der Hand. Als erstes denken wir an Unwohlsein durch die Schwangerschaft, was sich jedoch als unnötig erweist. Denn ihre Tochter hat sich ein- und die Mama ausgeschlossen inkl. dem noch stecken-gebliebenen Schlüssel in der Whg. !

    Natürlich ist der anstehende Arzttermin für uns alle nicht mehr so wichtig; denn nun gilt es nur das kleine Mädchen und Ihre Mutter raschest zusammen zu bringen.

    Die Erwachsenen rätseln und denken und denken und denken und denken und wollen telefonieren und organisieren – irgendwofür haben wir Feuerwehr, Polizei und Schlüsseldienst, dank Steuern und Hirn!

    Mein Kleiner (3j) hält immer noch sei Zündholz und lässt es nun zünden: „Papi, Mami, komm beten mit liebe Gott“ Die kleine Schwester (1 1/2j) sitzt dazu und macht auch mit….

    Plötzlich weiss ich, wo die Leiter ist, um via Balkon zum Kleinen Nachbars-Mädchen zu gelangen und ihm via Sichtkontakt zu helfen die türe zu öffnen.
    Die Ausgangslage ist nicht so, dass das Mädchen nun wüsste, warum es genau diese Tür, von mir als Nachbars-Vater auf dem Balkon erklärt,, öffnen sollte, geschweige denn WIE zu öffnen. Meine Anleitungsrätschläge müssen erst verstanden werden neben dem Drang aufs Häfi zu müssen in Begegnung mit mir als nicht-eigener Vater……..denn grundsätzlich darf das Mädchen keine Türen selber öffnen und hat es auch noch nie (Anmerk. der eignene Mutter)…..

    ehm, 1h später hielt die mama die tochter in den armen und mein Kleiner meinte im Kreise der Betroffenen: „danke lieb Gott chani mit XYXYX spiele“

  • Daniel Zollinger sagt:

    Zu meiner Zeit mussten wir noch in den Biblischen Geschichten Unterricht. Das ganze sollte ein Freifach werden. Wenn man sieht, wie die verschiedenen Religionen miteinander umgehen dann verstehe ich sowieso nicht warum man dann in der Schule den Kindern die Christlichen Werte vermitteln will. Beziehungsweise wo sind denn da die sogenannten „Werte“?

    • zysi sagt:

      sollen wir allen kindern das turnen und sporttreiben verbeiten, weil einige spitzensportler mit doping nicht als vorbilder dienen?

  • Chris M. sagt:

    Zuerst einmal: Extremismus, Intoleranz und Fanatismus sind gefährlich, egal von welcher Seite. Auch fanatische Agnostiker und intolerante Freidener sind gefährlich.

    Zuerst sollten wir die Fakten zur Kenntnis nehmen. Neben wenigen Freidenkern und Agnostikern gibt es viele mehr oder weniger konsequente Gläubige oder Anhänger von vielen Religionen (weltweit etwas ausgeprägter als in Europa). Sollte aus diesem Nebeneinander nicht durch Manipulation und und Angst aus Unkenntnis (böse Moslem, Minarette!!) ein Gegeneinander werden sondern ein Miteinander, dann ist gegenseitiges Verständnis und Toleranz notwendig. Verstädnis setzt Verstehen und Wissen voraus, zuerst einmal der eigenen Positionen und Standpunkte, dann derjenigen der anderen.

    Aus dieser Sicht ist es zwingend für ein gutes Zusammenleben, das Wissen über und das Verstehen von anderen Religionen und Kulturen zu fördern, gerade auch in der Schule. Dabei ist es naheliegend, sich zuerst einmal den Mehrheiten zuzuwenden, dh. den grossen Religionen und Kulturen, und später vielleicht auch die Minderheiten zu berücksichtigen (lokal wichtige Gruppen, Minoritäten wie Freidenker und andere). Vieles davon kann im Rahmen verschiedener Fächer wie Geschichte, Geographie, Kunst geschehen, aber grundlegende Zusammenhänge brauchen einen eigenen Platz, eben das Fach „Religion und Kultur“.

    Die Schwierigkeit besteht natürlich, über Religionen und Kulturen objektiv zu sprechen. Wie leicht erliegen wir der Gefahr, zB. andere Kulturen gegenüber der westlichen Kultur als minderwertig oder rückständig darzustellen. Stehen wie den eigenen Positionen genau so kritisch gegenüber, wie wir es gegen andere Postitionen sind? Für die „Wissenschaftsgläubigen“: wie halten wir es mit radioaktivem Müll und verseuchten Ländern, wie halten wir es mit Umweltzerstörung und Ausrottungen von Tieren und Pflanzen? Wie sehen wir die verheerenden gesellschaftlichen Folgen von Individualismus und Egoismus, wenn wir Gedankengut der Religionen verteufeln, die sich viele Gedanken über Zusammenleben, Gemeinschaft, Unterstützung der Armen und anderes machen.

    Ethik ist in diesem Zusammenhang wichtig. Aber einerseits ist die Geschichte der Ethik stark von Religion geprägt, andererseits ist auch moderne Ethik nicht wirklich religionsfrei, dh. frei von Glaubenssätzen. So müsste man eher von „Ethiken“ sprechen, je nachdem auf welches Dogma denn die jeweilige Ethik aufbaut. Und gegen jede der diversen Schulen gibt es wieder Einwände und Widersprüche. Auch hier ist Neutralität und Objektivität schwierig.

    Ich bin froh, dass nicht alles aus den Lehrplänen gekippt wird, auch wenn die Schule in allem Bemühen die Perfektion nicht erreicht.

    • Im urbanen Raum wachsen 25-30% der Kinder in weitgehend religionslosen Haushalten auf. Es ist kein Problem, dass ihnen in der Schule Grundbegriffe der grossen Religionsgemeinschaften beigebracht werden. Es geht aber nicht an, dass man sie negiert, sie in keiner Form abholt. Auch diese Kinder entwickeln Wertvorstellungen, denken und handeln moralisch gleich gut wie ihre gläubigen Klassenkameraden. Es ist unabdingbar, dass alle Kinder im Fach dieselbe Wertschätzung erhalten, unabhängig davon, ob sie irgendein Religionsgebilde als auf sie zutreffend empfinden oder nicht. Doch das tut das Fach eben nicht. Es suggeriert, in dem es alles andere totschweigt, dass gesellschaftliche Werte an Religiosität gebunden seien.

      Wenn das Fach eine Daseinsberechtigung haben soll, dann muss es das einander Verstehen gegenseitig fördern. Dient das Fach hingegen nur dazu, die gottlosen Kinder dazu zu zwingen (es ist ein Noten- und damit auch ein Selektionsfach), ein paar Begriffe und Jahreszahlen der Weltreligionen zu erlernen, währenddem sich religiös geprägte Kinder nicht mit säkularen Wertvorstellungen auseinander seetzen müssen, verkommt es zum traditionellen, missionarisch geprägten Religionsunterricht, dem laut Bundesverfassung niemand unter Zwang ausgesetzt werden darf.

      Es ist übrigens ein sehr heikles Postulat, alleine die Anzahl Mitglieder einer Glaubens- oder Wertegemeinschaft als Basis dafür zu nehmen, ob sie Erwähnung finden soll oder nicht. Rein zahlenmässig gesehen ist das Judentum weder in Zürich noch in der Schweiz noch auf globaler Ebene von grosser Bedeutung. Dennoch wäre es widersinnig, den jüdischen Glauben im Fach nicht angemessen zu berücksichtigen.

      • Chris M. sagt:

        Das Fach tut nichts – Lehrpersonen tun es mehr oder weniger erfolgreich.

        Und religiöse Kinder und andere Kinder lernen die nicht-religiösen, säkularen Dinge in alle anderen Fächern wie Mathe, Naturwissenschaften, Sport, ……

  • Hans Mustermann sagt:

    Gott bzw seine Stellvertreter auf Erden haben weder im Unterricht noch in der Regierung einen Sitz einzunehmen. Wohin das führt sieht man ja an genug schlechten Beispielen wo Menschen im Namen irgendeines Gottes „Recht“ sprechen und der Gesellschaft aufzwingen wollen was richtige verhalten ist. Gegen Ethikunterricht ist nichts einzuwenden. Da sollten aber alle Religionen und Aspekte durchgenommen werden. Was für mich keinen Platz im Unterricht hat sind einseitige Ansichten.

    • lisa sagt:

      Warum immer nur die schlechten Beispiele nennen? Gibt es nicht auch genügen Menschen die mit der Kraft ihres Glaubens, und da meine ich keine fundamentalistisch verbohrte Vorstellung, sehr viel Geutes bewirkt haben? Aber die schaffen es ja im Allgemeinen in keine Schlagzeile. Religion hat meiner Meinung nach keinen Platz in den öffentlichen Funktionen verdient, solage sie (egal welche) zur Machtausübung missbraucht wird. Schaut man genau hin, sind solche Missbräuche auch gegen die Grundsätze (zumindest) der christlichen Religion, die als eine der Hauptaussagen beinhaltet, seinen nächten zu lieben wie sich selbst. Ihn also so zu behandeln, wie ich gerne an seiner Stelle auch behandelt werden möchte. Wenn die Kinder das in der Schule lernen, habe ich absolut nichts gegen einen solchen Unterricht. Im übrigen ist Fundamentalismus meiner Meinung nach nicht den Religionen vorbehalten, gewisse Atheisten reagieren genauso heftig gegen religiöse Menschen, wie religiöse Fundamentalisten. Insofern bietet ein Ignorieren der Religionen auch kein Schutz vor Fundamentalismus.

      • Brunhild Steiner sagt:

        Kann mich nur anschliessen, und es macht ja vor der Nächstenliebe nicht Halt,
        einerseits wird auch zur Selbstachtung/“sich selber mögen und gut zu sich schauen“ aufgerufen
        („liebe deinen Nächsten WIE dich selbst“) und andererseits gibts da auch den Begriff „Feindesliebe“,
        das war und ist schon ziemlich revolutionäres Gedankengut dass man jenen,
        welche einem verachten und Steine in den Weg legen, Gutes tun soll….

      • Tom sagt:

        Ich staune immer wie breit das Kreuz von Mutter Teresa ist das sich tausende Inquisitoren, Kriegführende Päbste, Kinderschändende Priester usw dahinter verstecken können. Die Guten Taten der Kirche sind nur die Weitergabe eines Teils der Spenden (minus Verwaltungsaufwand und Eigenbedarf) oder die Nutzung der Spenden um Kindergärten und Pflegeheime zu bauen die für die Kirche Gewinn generieren.

        Und das Atheisten heftig werden kann ich verstehen. Wenn sie Auftauchen arbeiten zur not auch Ratzinger und Bin Laden zusammen.

      • Globetrotterin sagt:

        @Tom, 11:03:
        Das nennt man die „Vatikan-Teheran-Connection“.

    • Benjamin Hitz sagt:

      Den Worten Jesus entsprechend, hat die Religion tatsächlich nichts in der Poltik zu suchen, auch wenn die Kirche dies immer mal wieder anders sah. Aber „Gebt dem Kaiser, was des Kaisers ist und gebt Gott, was Gottes ist“, war nicht einfach nur Cocktailparty-Geplauder von einem Langhaarigen Antik-Hippie. Das gehört ja genau zu den Dingen, die es lohnenswert machen, den Kiddies ein Bisschen Grundlagen des Christentums beizubringen. All die drolligen Freidenker und Atheismus-Begeisterten heutzutage vergessen ja dauernd, dass Jesus DER Prototyp des Freidenkers überhaupt war.

      • Tom sagt:

        Seit wie die Vögel unter dem Himmel… ist eher die Vision eines Nitdenkers.

      • Benjamin Hitz sagt:

        @Tom: Den Eintrag kapiere ich jetzt nicht, aber vielleicht ist das auch gar nicht nötig. Was genau wollen sie sagen?

      • Abramelin sagt:

        als hätte es vor Jesus keine Freidenker gegeben…

        Ich glaub Sokrates lebte ein wenig früher, so als Beispiel 😉

        Das Argument von Jo Moth finde ich gut.. dem Kind die Instrumente an die Hand geben um selber zu entscheiden.
        Kritikfähigkeit, Reflexions-Fähigkeit und die Offenheit auch andere Standpunkte zuerst du akzeptieren und erst dann durch Argumente zu prüfen und erst dann eine Meinung zu bilden, das sollte ein reifer Mensch meiner Meinung nach können.

      • Benjamin Hitz sagt:

        Wer hat denn behauptet, dass es vor Jesus keine Freidenker gegeben hat. Aber wenn man etwas kritisiert, wäre es doch supi, wenn man auch eine Ahnung davon hätte und diese vermisse ich bei den meisten meiner Mitagnostiker und bei den Atheisten grad sowieso.

    • Gianin May sagt:

      Genau und da Sie den Religionsuntericht ersetzen wollen, ist nicht einseitig. Sie wollen der Gesellschaft die Religionslosigkeit ja auch nicht aufdrängen – es soll sich selbstständig rauswachsen – oder rausgebrochen werden?

      • Hans Mustermann sagt:

        @Gianin May
        Daran die Vielfallt aufzuzeigen ist sicher nichts einseitiges.
        Religionsunterricht also das Unterichten einer spezifischen Religion gehört zur jeweiligen Religion und hat im Schulunterricht nichts verloren. Dies soll aussschliesslich auf freiwilliger Basis besucht werden können und soll von den Religionen selber organisiert udnd finanziert werden.
        Ethikunterricht sollte die verschiedenen Religionen und Ethikmodelle anhand ihrer Gemeinsamkeiten sowie Unterschiede aufzeigen und auch aufzeigen wohin Glauben an eine Idee führen kann. Da gibts zuhauf negative wie auch ein paar positive Beispiele.

  • Jo Mooth sagt:

    Dem Kind die Instrumente in die Hand geben, damit es später selbst entscheiden kann? Warum das Kind dann nicht z.B. in die FDP einschreiben, es ab Schulalter auf Parteiversammlungen schicken, damit es später mal nicht den Kommunisten oder gar der Autopartei beitritt? Es geht um Beeinflussung, und so ein Fach ist wohl ohne gar nicht unterrichtbar, weil da dauernd irgendwelche christlichen Schnipsel in den Unterricht einfliessen. Rüstzeug, um später nicht irgendeiner Sekte beizutreten, kann dem Kind auch in ganz normalen Fächern und – sofern sowas zu Hause betrieben wird – der Erziehung verschafft werden.

    • rosi sagt:

      Der Vergleich hinkt aber sehr. Wenn man mal nachschaut, basiert auch eine politische Partei und Politik im Allgemeinen hierzulande auf christlichen Werten (von wenigen Ausnahmen einmal abgesehen).

      • Erich sagt:

        Christliche Werte wie: Liberalismus, Auslaenderfeindlichkeit, Populismus, Umweltschutz, Sozialismus? Wuerde mal sagen Ausnahmen sind eher die Regel…

      • ohno sagt:

        Und welche dieser christlichen Werte haben andere nicht, sind also von den Christen erfunden/entdeckt/entwickelt worden?

      • rosi sagt:

        ohno, da das Christentum meines Wissens die grösste (quantitativ betrachtet) Weltreligion ist, finde ich es legitim, von christlichen Werten zu sprechen.

      • Tom sagt:

        Christliche Werte, da bekomme ich immer einen Lachkrampf. z.B. Du sollst nicht töten. ich habe noch nie gehört das sich die Mitglieder eines Rudels gegenseitig töten und Tiere können nicht lesen. Menschen als grosses und schlaues Rudel brauchen dafü ein Buch? Du sollst nicht stehlen gibt es im Tierreich aber nicht. Magels Privateigentum. UNd ausser dem Kommunismus, der davon lebt gibt es keine Gesellschaftsform die das gut heisst. Auch ohne Bibel.
        Der Irrtum der Christenheit ist das sie nicht merken wollen das Kulturen älter sind als 2000 Jahre. Sogar ihre eigene.

      • ohno sagt:

        rosi, da die Frauen (quantitav betrachtet) meines Wissens die größte Bevölkerungsgruppe auf der Welt sind, ist es wahrscheinlich sinnvoller, von weiblichen Werten zu sprechen. Das wäre dann genauso logisch.

    • rosi sagt:

      tom, Mitglieder der eigenen Art töten oder bestehlen kommt auch im Tierreich vor, auch wenn Sie persönlich vielleicht noch nichts davon gehört haben.

  • Grazia Annen sagt:

    Problematisch ist, dass Religion und Kultur als Doppelpack angeboten wird und beides apriori als etwas Positives gelten. Auch Sklaverei gehörte zur Kultur der Antike (Rom, arabische Welt, Eroberungen unter dem Kreuz), sie wird auch heute noch mancherorts praktiziert, obwohl wir sie nicht mehr so nennen, meist rechtfertigt ein Gottesglaube die Einteilung der Menschen in „Bessere“ und „Niedrigere“. Erst durch die säkulare Rechtssprechung haben wir solche Diskriminierungen (zbsp. gegenüber der Frau) aufheben können. Will jemand all die Errungenschaften, die blutig erkämpft werden mussten gegen geistliche und weltliche Herrscher, tatsächlich relativieren?

    Wissen ÜBER Religionen und ihre Auswirkungen auf die Geschicke der Menschen ist wichtig, es kann und wird sehr wohl in andern Fächern vermittelt., zBsp. im Geschichtsunterricht, das war übrigens auch das Fach, in dem ich persönlich am meisten FAKTEN über das Christentum sammeln konnte. Auch die News zeigen ja gerade in jüngster Zeit plastisch, was im Namen der „Kultur“ passieren kann.

    Dass es, nicht zuletzt seit dem 11. September, eine staatlich beförderte Einschwörung auf die „christlichen Werte“ gibt scheint mir offenkundig.. Vor 30 Jahren lernten wir, dass die Wiege unserer Kultur in Ur liegt. Heute beginnt im Geschichtsunterricht der Oberstufe die Zeitrechnung mit dem Christentum, dem 3/4 des ganzen 1. Jahres gewidmet wird. Es finden sich da auch hübsche Repetitionsfragen wie: was leistet die Kirche auch heute wichtiges im sozialen Bereich (die erwünschte Antwort sind natürlich Krankenhäuser, Altenheime, u.ä.), als grosse Vorbilder werden M.L. King, A. Schweitzer und Mutter Teresa angeboten. Gerade in letzterem Fall wäre eine etwas kritischere Betrachtung angebracht. (S. Geschichtsbuch für die Oberstufe, Lehrmittelzentrale des Kt. Zürich). Ach ja, und der Schüler wird gefragt, was er ALS CHRIST Gutes tun kann…… Somit wird meinen Kindern diese Fähigkeit en passant abgesprochen.

    Das Fach wird sicherlich mit Händen und Füssen verteidigt werden in der Hoffnung, dass sich niemand dagegen wirklich wehrt und so ein fait accompli daraus wird.

    Wirklich stossend ist m.E. die Tatsache, dass der Religionsunterricht unter neuer Flagge und Namen wieder OBLIGATORISCH wird, nachdem man sich in einigen Kantonen bislang wenigstens theoretisch dispensieren lassen konnte. Was wohl aber nicht gross genutzt wurde, entweder um das Kind nicht „auszugrenzen“ oder weil der konfessionelle Religionsunterricht der Kirchen systematisch innerhalb der Blockzeiten angeboten wird (wenigstens in meiner Erfahrung). Merkwürdigerweise wurde die alternative Betreuung, so sie denn angeboten und den Eltern auch KOMMUNIZIERT wurde, rege beansprucht. Leider war die Betreuung rein physisch, die Kids wurden in dieser Zeit nicht unterrichtet, wohl weil die andern in dieser Zeit ja auch nix lernten. Wo kämen wir denn hin, wenn die einen biblische Parabeln besprechen und die andern das 1×1 repetieren!

  • rosi sagt:

    Hier wird immer aus Erwachsenen-Sicht argumentiert. Warum sollen Kindern nicht christliche Werte und Traditionen vermittelt werden, wo doch in dieser Gesellschaft mehrheitlich Christen leben? Warum darf ein Kind keinen naiven Gottglauben haben dürfen? Es ist tröstlich für ein Kind, beten zu können und zu wissen, dass Gott seine Hand über es hält und es beschützt. Und es soll auch wissen, warum beispielsweise Weihnachten gefeiert wird. Es ist doch wichtig, ersteinmal über diese Grundlagen zu verfügen und in seiner eigenen Kultur, zu der auch die Religion zählt, verwurzelt zu sein. Ab einem gewissen Alter erst kann sich ein Kind mit diesen Gedanken kritisch auseinandersetzen, aber dann hat es eine Argumentationsbasis. Und da viele Eltern ihren Kindern diese Werte und Tradtionen nicht mehr vermitteln wollen oder können, ist m. E. die Schule in der Pflicht. Wichtig für mich ist, dass der Religionsunterricht frei von Missionierung und Zwang ist.

    • Jo Mooth sagt:

      Dass Christen hier (noch) in der Mehrheit sind ist doch kein Grund, Kindern das Christentum einzutrichtern? Hat denn nicht jeder Mensch das Recht, frei zu entscheiden, ob er überhaupt an Transzendentales und wenn ja woran er denn glauben will?

      • „Dass Christen hier (noch) in der Mehrheit sind“: hier spricht die grenzenlose Dummheit jener, die glauben, begriffen zu haben „wie der Hase läuft“. Vielleicht lassen einmal gerade Ihre Kinder ihre „Atheismus-Blase“ platzen, weil sie einen gläubigen Christen, Muslim, Juden ehelichen und sich dann plötzlich vieles ändert, auch wenn Ihre „hypostasierte Liebe“ bleibt.

      • Gianin May sagt:

        Warum sollten wir denn unseren Kindern überhaupt etwas beibringen. Die Forderung nach „Keine Religion“ ist ja schon fast religiös.

    • Globetrotterin sagt:

      Das Problem dabei ist, dass es sich bei Kindern um Prägung handelt, die später auch mit intellektuellen Argumenten nur sehr schwer wieder auszumerzen ist. Geprägt werden wir als Kinder, nicht als Erwachsene.

      • rosi sagt:

        Eine „freie“ Entscheidung ist doch überhaupt nicht möglich, ich werde doch IMMER durch Erziehung, Gesellschaft, etc. geprägt. Und die christlichen Werte sind wohl nicht die schlechtesten, die man vermittelt bekommen kann.

      • Brunhild Steiner sagt:

        Einverstanden was die Prägung in der Kindheit betrifft, bloss, geprägt werden sie so oder so.
        Was ist mit Glauben an die Glücksbringerhalskette, das Hufeisen, das 4blättrige Kleeblatt und ähnlichem?

        Es liegt an den Erwachsenen diese Prägung, aus welcher Ecke nun auch immer, so vorzunehemen dass nie eine Indoktrination stattfindet und sich das Kind auch davon lösen dürfte. Wenn aber diese Freiheit grundsätzlich zugestanden wird, sehe ich keine gröberen Probleme. Im Gegenteil, mit meinen Kindern erlebe ich Dimensionen welche ich nie für möglich gehalten hätte, sie kommen zu Schlussfolgerungen, Erkenntnissen, Wahrheiten welche ich nicht einfach vorgebetet haben, sondern welche sie sich, in Auseinandersetzung mit „Transzendenz“ selber erarbeitet haben. Und die sich in ihrem Alltag, in unserem Leben ganz greifbar auswirken, fassbar sind.
        Hätte ich ihnen aber nicht von Anfang an das „Ausgangsmaterial“ zur Verfügung gestellt,
        dann wären sie heute um viele Erfahrungen ärmer.

    • the man sagt:

      … das ist doch für Atheisten kein Problem: Wenn alle anderen Kinder Weihnachten feiern bleibt es zu Hause halt Alltag. Wenn das Grossi stirbt sagt man dem Fünfjährigen „das ist jetzt tot, unwiederbringlich, vermodert und nichts bleibt zurück, ende aus!“. Und auf die Frage nach dem Sinn des Lebens kann man ja eventuell auf ökonomische Theorien verweisen…
      oder doch nicht?:-)

      • Globetrotterin sagt:

        Schon mal was von Ethik gehört? Damit meine ich nicht verlogene christliche Doppel-Moral. Der Unterschied zwischen Ethik und Moral dürfte klar werden, sobald man an die sog. „Ethik-Kommissionen“ denkt. Eine „Moral-Kommission“ würde bei mir kalte Schauer verursachen.

      • Brunhild Steiner sagt:

        Verlogen und komplett auf der falschen Bahn waren einzelne Menschen und Menschengruppen,
        aber nicht die eigentliche „christliche Botschaft oder Lehre“.

      • Orlando S. sagt:

        Nein da kann ich mir nichts vorstellen, erklären sie un doch mal „Ethik“, Frau.

      • the man sagt:

        🙂 würde zugerne mal „ethische“ Antworten auf existentielle Fragen hören, ohne dass sich diese in irgendeiner Form religiös anlehnt…

      • Globetrotterin sagt:

        Ihnen muss man aber auch immer wieder alles erklären, Mann! Selber denken macht schlau!

      • Orlando S. sagt:

        Ich soll für sie das Denken übernehmen, Weib? Ja, dann würde ich weitgehend meiner anthropologischen Rolle gerecht. Aber ich bin ein Frauenfreund, deshalb möchte ich, dass sie gnä Frau darüber nachdenken, was denn „Ethik“ minus das „patriarchalische“ christlich-jüdische Fundament (da können sie die Macho-Griechen gleich mitreinnehmen) ist und nicht einfach mit Schlagwörtern um sich werfen, die sie im Grunde gar nicht verstehen.

        Ich will ihnen ja nur helfen, meine Liebe!

      • Globetrotterin sagt:

        Von Ihnen würde ich mir zuallerletzt vordenken lassen, Sie Pseudo-Anthropologe! Frauenfreund? Ha, ha, ha!

      • Orlando S. sagt:

        sie weichen aus. Also, welche Werte nehmen sie als Fundament für ihre „Ethik“?

        Die Tafeln mit den 10 Geboten könnens ja nicht sein, weil die vom Patriarchengott an den Chauvi Moses übergeben wurden. Die Ägypter, Griechen und die anderen Nahöstler waren auch alle Machos. und Emilie Lieberherr kam erst nach dem 2. WK…hmmm…was nun?

        Mal sehen, wie sie mit ihrer weiblichen Schläue das Problem lösen!
        Wieder die sagenhaften von Ihnen behaupteten vorhistorischen feministischen Amazonen-Hochkulturen, die es nie gab?
        Oder vielleicht ausserirdische Astronautinnen?

      • Globetrotterin sagt:

        @Orlando:
        Was sind Sie doch für ein Schlaumeier! Auf einen solchen Quatsch kann kein vernünftig denkender Mensch eingehen. Sie sollten sich mal untersuchen lassen. Es gibt da so eine Institution im Norden von Zürich.

      • Orlando S. sagt:

        Jaja, mein Hirn funktioniert nicht richtig, blabla…item:

        Wir warten alle gespannt auf ihre Ausführungen zur unchristlichen, unpatriarchalischen Ethik! Na los, worauf warten sie?

      • Orlando S. sagt:

        Tictactictac…das Frauenzimmer kneift mal wieder mit ihren „intellektuellen Argumenten“ (Zitat 09.43). *höhnisch lach*

      • Globetrotterin sagt:

        Ein klarer Fall von ekklesiogener Neurose.

      • fufi sagt:

        fufi das Photon grinst:

        jetzt schlagen sie sich sogar wegen „Ethik“ die Birnen blutig.
        Contradictio in adjecto?¨
        oder eifach chrank?

        und mit c ab in Schterne!

  • Mirjam sagt:

    Ich bin aus der Kirche ausgetreten, meine Kinder sind auch nicht Mitglied der Landeskirche. Wir haben beide nach der Geburt einsegnen lassen (keine Taufe, sondern Segnung). Mein Mann und ich wollen, dass sie später einmal selber bewusst entscheiden können ob sie getauft werden wollen oder nicht. Und ob sie in den Religionsunterricht gehen wollen oder nicht. Es soll ihre ganz individuelle, persönliche Entscheidung sein. Religion ist ein Herzensthema und ich will dass sie selber entscheiden können, woran sie glauben wollen. Ich bin auch der Meinung, dass Religion kein Pflichtfach sein darf, sondern fakultativ sein muss.

  • Rahel sagt:

    Wir haben uns auch schon ernsthaft überlegt, unsere ältere Tochter aus dem Religions-Unterricht zu nehmen, weil ihre Lehrerin einen Riesen-Chabis von sich gibt!

    • Diese Situation kenne ich. Wir namen dann die Bibel und lasen die Geschichte im Wortlaut und siehe da: das ganze Moralin hatte die Religionslehrerin hineingeschwurbelt. Es war wohl die wichtigste Religionslektion. Wir akzeptieren nur die Bibel in ihrem Wortlaut und daraus ziehen wir unsere Schlüsse. Jeder Religionslehrer ist auch nur ein Mensch und kann fehlen. Wenn man aber das Kind aus dem Religionsunterricht nimmt, dann lässt man es glauben, die Eltern seien „unfehlbar“. Und wehe den Eltern, die „unfehlbar“ sein wollen.

      • Rahel sagt:

        Nein, nein, die Absicht, uns Eltern als unfehlbar darzustellen, steckt wirklich nicht hinter diesem Gedanken ( da hat sie im Alltag genügend Gelegenheit, zu sehen, dass auch wir Fehler machen, und wir die auch eingestehen) ! Aber wir merken, wie es unsere Tochter selber belastet ( ohne unser Hinzutun! ) wenn die Religionslehrerin etwas anderes erzählt als sie es von der Bibel her weiss!

      • Brunhild Steiner sagt:

        was erzählt sie denn?

      • Rahel sagt:

        Ich weiss es aus dem Stehgreif nicht ausführlich, da müsste ich in ihrem Heft nachschauen. Aber es werden einfach grundlegende Sachen verneint, verdreht oder gar lächerlich gemacht, z. B. hat sich Weihnachten nicht so ereignet wie in der Bibel beschrieben oder Jesus selber ist nicht so, wie man von ihm in der Bibel liest.

  • Brian sagt:

    Der Brian auf dem Bild ist übrigens der _richtige_ Brian.

  • vietnamesische begleiterscheinung sagt:

    bezüglich religion empfehle ich den film religulous!

    http://www.lionsgate.com/religulous/

    • Brunhild Steiner sagt:

      ehemaliger Dschungelkämper? Dieser Film bedient die gängigen Klischees, mehr nicht,
      der Regisseur wusste schon, weshalb er Leute mit Haltungen wie
      chr 8:00
      StefanB 9:00
      Benjamin Hitz 9:14
      the man 9:09
      Bruno Waldvogel 9:09
      und viele weitere die noch schreiben werden
      NICHT zu Wort kommen liess.
      Sie hätten es ihm nämlich verunmöglicht der Diskussion auszweichen indem er sich einfach lustig macht und alles ins Lächerliche zieht. Hinterfragen und Kriitk in Ehren, aber immer den Blick aufs Ganze gerichtet halten.

      • vietnamesische begleiterscheinung sagt:

        @ brunhild

        jep, ich bin der ehemalige vietcong 🙂

        du hast nicht unrecht. der film IST sehr einseitig. aber nicht zu unrecht! auch muss man ihn im umfeld einer religiös-fundamentalistischen usa verstehen. aber im grunde hat er vollkommen recht. religion war bis dato immer eine der gesellschaftlichen strömungen die es am besten und effizientesten schafften, die menschheit auseinander zu dividieren, unsägliches, grausames und blutiges leid quer über den gesamten globus und durch die gesamte geschichte der menschheit zu verbreiten. ich wollte dem wäre nicht so. aber man muss klar sagen, dass die von uns hochgehaltenen werte wie menschlichkeit, toleranz und mitgefühl KEINE errungenschaften der religionen sind und auch nie waren. es sind dem menschen innewohnende konzepte die die religion auf allen stufen bekämpft. die sich glücklicherweise aber auch immer wieder gegen sie, die religion, behaupten.

        natürlich gibt es viele gemässigte mitglieder sämtlicher religionen. doch schaffen es die praktisch nicht, den fundamentalistischen strömungen einhalt zu gebieten. religion ist eine gefahr. ein system dass auf angst und blindem gehorsam aufbaut, kann nicht zum guten führen.

        schauen sie sich die welt an. wir leben praktisch im dritten weltkrieg. ein religionskrieg globalen ausmasses mit hundertausenden von toten. religion lässt sich hervorragend politisch nutzen – siehe den usa-terror im irak und afghanistan, siehe islamistischer terror. auf den gurtschnallen der nazis zierte der spruch ‚gott mit uns‘.

        religion ist bei weitem nicht der einzige grund warum sich menschen umbringen. aber wohl einer der am unverständlichsten ist, da doch alle religionen nicht müde werden von der allumfassenden liebe gottes zu sprechen.

      • Brunhild Steiner sagt:

        @Hallo Begleiterscheinung…;-)
        warum denn die Namensänderung nachdem Sie sich mit Ausdauer allen Namenshinterfragern widerstanden haben, bin also fast ein bisschen enttäuscht!…;-)
        Aber zur Sache, nicht ganz einverstanden, extremistische Strömungen finden sich überall und egal um was es eigentlich geht, mit mal mehr und mal weniger blutigen Auswirkungen.
        Das „Gottesliebekonzept“ ist weder in „allen Religionen“ vorhanden,
        noch wo vorhanden übereinstimmend definiert!
        Das Konzept der Feindesliebe, wie sie von Jesus Christus als Aufruf überliefert ist, hebt sich da nochmals um Dimensionen von jedem menschlichen Verständnis und natürlichem Empfinden ab, von daher lässt sich durchaus die Frage stellen, ob es nicht doch eine transzendente Wirklichkeit gibt, welche versucht uns auf Dinge aufmerksam zu machen.
        Die grossen Probleme unserer heutigen Zeit führe ich ebenso auf die Religion des Mammon zurück, welche eine Verhärtung der Herzen mit sich zieht und ungleiche Verteilung der Güter und Ausbeutung als gerechtfertigt ansieht. Mit christlichen Grundsätzen lässt sich keine einzige dieser Werthaltungen unterstützen.

      • vietnamesische begleiterscheinung sagt:

        @ Brunhild Steiner

        naja, ich wechsle des öfteren mal meinen namen. daran ist nichts ungewöhnliches. ich achte jedoch darauf, dass der wechsel nicht allzuhart ist und man mich auch am neuen namen erkennen kann 🙂

        ja, du hast recht, extremistische strömungen finden sich an vielen orten. doch nicht an allen sind sie gleich schädlich. die religion zähle ich zu den orten, an denen extremistische strömungen extrem leicht entstehen, systembedingt, und extrem leicht zu lenken sind. blinde gefolgsleute findet man nirgens so viele auf einem haufen, wie bei den religionen. und religionen haben den schädlichen vorteil, dass sie den tod ihrer mitglieder als etwas positives darstellen. im sinne von: egal wie schlecht du bist, so lange du für unseren gott schlecht bist, wird er dich lieben.

        unter dem konzept von gottes liebe verstehe ich in erster linie die weltreligionen. vornehmlich der islam und das christentum. den zwei verdanken wir den meisten mist an kriegen, verfolgung usw. beide sind gleich intolerant und ihr hass aufeinander blickt auf jahrhunderte zurück. und nie hat ihnen jemand einhalt bieten können. beide töten für die liebe ihres gottes. weil gott ja sie liebt – und dementsprechend die anderen hassen muss.

        das konzept der feindesliebe findet sich vielleicht in einigen worten jesus, aber die katholische kirche hat damit nichts, aber auch gar nichts gemein. die schaffen es höchstens den eindruck zu erwecken, vermitteln zu wollen, aber uneingeschränkte liebe spüre ich da keine. weder gegenüber den juden noch gegenüber den muslimen und schon gar nicht gegenüber den nicht-gläubigen. welche ja eh alle in die hölle stürzen werden.

        es gibt keine transzendente wirklichkeit die uns auf irgendetwas aufmerksam macht. es gibt soziokulturelle regeln, wovon zb. moral eine ist, und die existiert unabhängig von religion. und die grossen probleme unserer zeit, sind die selben wie in allen zeiten davor, die auch in allen zeiten nach uns noch sein werden. gier und hass und fresssucht sind dinge die dem menschen innewohnen, genau wie liebe und toleranz und sämtliche anderen moralischen grössen. der mensch alleine verfügt über diese und kein himmlisches einhorn das auf einer sternschnuppe reitet.

        will heissen: der mensch braucht gott nicht um gutes zu tun. aber er braucht ihn oft um schlechtes zu tun.

      • Brunhild Steiner sagt:

        @vietnamesische Begleiterscheinung:
        (könntest Du beim nächsten Wechsel wieder auf was kürzeres umrüsten?…;-) )
        das verstehe ich nicht ganz:
        „dass sie den tod ihrer mitglieder als etwas positives darstellen. im sinne von: egal wie schlecht du bist, so lange du für unseren gott schlecht bist, wird er dich lieben. “
        Den natürlichen Tod oder den gewaltsamen Tod aufgrund eines Angriffes?

        Wenn ich von Glauben spreche meine ich damit nicht die katholische Kirche als Machtapparat.
        Gott als eine grundsätzliche, liebende Instanz existiert im Islam nicht, und man kann sich da des Heiles auch nie wirklich sicher sein; da bestehen also ganz enorme Unterschiede.
        Sie haben sich auch nicht von Beginn weg gegenseitig aufs Dach gegeben,
        die eine ist nämlich ein ziemliches Stück älter als die andere.

        Sobald die Debatte in Richtung Wert des Menschen geht, Wertigkeit von behindertem Leben usw. ist die soziokulturelle Regel oder „Moral“ nicht mehr ganz frei schwebend, sondern jeder Einzelne leitet seine Moral, oder sein „für gut befinden“ einer soziokulturellen Regel, auch von seinem inneren Weltbild, seinen Überzeugungen ab. Ich sehe keinen Gewinn darin die Möglichkeit einer transzendeten Dimension komplett in Abrede zu stellen, bloss weil auch Missbrauch damit betrieben wird. Werte wie Vergebungsbereitschaft, Barmherzigkeit, Güte usw. sind für mich neutestamentlichen Ursprunges. (wobei auch schon ganz klar im AT feststellbar)

      • vietnamesische begleiterscheinung sagt:

        @ Brunhild Steiner

        „(könntest Du beim nächsten Wechsel wieder auf was kürzeres umrüsten?…;-) )“

        einfach copy-pasten 😉

        „Den natürlichen Tod oder den gewaltsamen Tod aufgrund eines Angriffes?“

        natürlich den gewaltsamen tod.

        „Gott als eine grundsätzliche, liebende Instanz existiert im Islam nicht, und man kann sich da des Heiles auch nie wirklich sicher sein; da bestehen also ganz enorme Unterschiede.“

        gott ist auch im christentum keine liebende instanz. er ist ein eifersüchtiger gott, der keine anderen neben sich duldet. glaub mir – islam und christentum haben mehr gemeinsam als denen lieb sein dürfte. der liebende gott wird zwar immer wieder verkündet – oft auch mit jesus verwechselt. aber als liebender gott, so wie ich liebe verstehe, hat er nie existiert. jetzt kann man natürlich sagen, ich weis als nichts um die liebe.

        „Sie haben sich auch nicht von Beginn weg gegenseitig aufs Dach gegeben, die eine ist nämlich ein ziemliches Stück älter als die andere.“

        auch das spielt keine rolle. solange es mehr als eine weltanschauung, mehr als eine religion gibt, gibt es deswegen krieg. wer jetzt zuerst war, spielt überhaupt keine rolle. das christentum ist auch nur ein plagiat des judentums und diese möglicherweise eines der ägypter usw. am ende entspringt alles irgendeinem einzeller der mal an gott dachte. na, ist das nicht eine hübsche zusammenführung von evolutionspraxis und schöpfungsgeschichte? 😉

        „Sobald die Debatte in Richtung Wert des Menschen geht, Wertigkeit von behindertem Leben usw. ist die soziokulturelle Regel oder “Moral” nicht mehr ganz frei schwebend, sondern jeder Einzelne leitet seine Moral, oder sein “für gut befinden” einer soziokulturellen Regel, auch von seinem inneren Weltbild, seinen Überzeugungen ab.“

        nicht nur! moral ist in allen bereichen und schon immer eine dehnbare grösse gewesen, die sich immer ihrer umwelt angepasst hat.

        „Ich sehe keinen Gewinn darin die Möglichkeit einer transzendeten Dimension komplett in Abrede zu stellen, bloss weil auch Missbrauch damit betrieben wird. Werte wie Vergebungsbereitschaft, Barmherzigkeit, Güte usw. sind für mich neutestamentlichen Ursprunges. (wobei auch schon ganz klar im AT feststellbar)

        ich sehe keinen grund, dem menschen ur-eigene werte einer illusion zu überantworten! güte und barmherzigkeit sind keine erfindungen der bibel. es sind grundlegende prinzipien des zusammenlebens, die in allen kulturen und zu jeder zeit bedeutung haben. der mensch soll die verantwortung selber tragen! religion ist letztlich bloss ein produkt aus faulheit und angst. nichts mehr und nichts weniger. und wenn im namen der religion gutes geschiet, ist es nicht das verdienst der religion, sondern der mensch der sich innerhalb dieses systems behauptet.

      • Brunhild Steiner sagt:

        @vietnamesische Begleiterscheinung: wir werden uns da wohl nicht finden…, ganz klar finde ich nach wie vor dass sehr entscheidende Unterschiede auszumachen sind. Und das Christentum sehe ich nicht unbedingt als Plagiat, ganz korrekt betrachtet sind die Christen „eingepropft“, denn Jesus war der jüdische Messias, und es gibt messianische Juden- also Juden die an Jesus glauben, aber innerhalb ihrer jüdischen Traditionen soweit sie nicht durch die Lehren von Jesus aufgehoben worden sind.
        Somit ist das Christentum auch keine „westliche“ Religion, es kommt aus dem Nahen Osten wie Du richtig bemerkst.

      • vietnamesische begleiterscheinung sagt:

        @ Brunhild Steiner

        du meinst also, dass werte wie güte und barmherzigkeit nur aufgrund von religiösem einfluss in die welt kommen? und sonst nicht?

        nein, jesus war nicht der jüdische messias. das christentum ist eine splittergruppe vom judentum, dass schon jahrtausende vorher existiert hat. evtl. vergleichbar mit den heutigen freikirchen die sich von der katholischen kirche abspalten. natürlich gibt es juden, die an jesus glauben, genauso wie es muslime gibt die an ihn glauben, genauso wie es christen gibt, die an mohammed glauben. überall wird es immer leute geben die der linie streng folgen und von unterschieden sprechen und solche, die offen an die dinge heran gehen und von gemeinsamkeiten sprechen. es spielt auch keine rolle, welche religion am ältesten ist. es gibt immer noch eine ältere aus der eine neuere entstanden ist. und genau das kapieren viele religiöse leute überhaupt nicht. sie glauben an ihre einfachen wahrheiten, damit sie nicht nachdenken müssen. traditionen und kulturen vermischen und trennen sich seit es menschen gibt. keine ist besser als die andere. keine ist wahrer als die andere.

      • Brunhild Steiner sagt:

        @vietnamesische begleiterscheinung:
        nein, das glaube ich nicht. Aber ich finde es nicht richtig die biblischen Schriften und/oder die Christen (und hier meine ich Menschen die sich bewusst für ein Nachleben der Lehre JC entschieden haben) anhand Fehlentwicklungen und gemachter Fehlinterpretationen „in der Luft zu zerreissen“.
        Oft wird dann auf alles was im Namen der Kirche (und da ist schon mal die erste Verwechslung begraben) fürchterlich schiefgelaufen ist verwiesen, um die Existenzberechtigung, oder Äusserung derselben, abzusprechen.

        Im Gegenzug fehlt das Wissen über alles Gute, was von genau diesem Buch (Bibel) inspirierte Menschen geleistet haben. Aufbau von sozialen Strukturen, Einsatz für Arme und Benachteiligte und generell Randständige (Gefangenenbegleitung zu ihrer Hinrichtung von John Wesley in England um nur ein kleines Beispiel herauszupicken.), Gründung von Waisenhäusern als sich niemand um Waise gekümmert hat usw etc.
        Hingehen an Orte die sehr unwirtlich und nicht lukrativ sind um Menschen zu helfen,
        nicht mit Worten sondern mit Taten-
        aber die Taten wurden inspiriert durch das Wort.
        Die Grundlagen zu solchem Verhalten lassen sich eben sehr wohl im neuen Testament finden.
        Das Christentum ist keine Splittergruppe aus Zeiten des AT, es gibt über 300, teilweise detailgenaue Prophezeiungen in nachweisbar sehr alten Büchern (ua Jesajarollen) welche sich auf Jesus anwenden lassen.
        Ich bin sehr davon überzeugt dass er der verheissene Messias ist.
        Weil ich eben auch glaube, dass wenn es eine Transzendenz gibt,
        dies eine personale und sich offenbart-habende ist.

      • Brunhild Steiner sagt:

        @vietnamesische Begleiterscheinung:
        Entschuldigung, beim nochmaligen Durchlesen kapier ich, dass ich Dich missverstanden habe, den Satz mit Splittergrppe aus dem AT kannst Du also streichen! Aber ich glaub eben auch nicht, dass das einfach eine Splittergruppe aus dem Judentum ist, sondern dass diese Menschen eine Begegnung mit ihrem wirklichen Messias hatten. Und erst die andauernde Ablehnung der „führenden religiösen Autoritäten“ hat dazu geführt, dass Paulus auf Missionsreisen zu den Heiden gegangen ist, ursprünglich hatte das niemand von denen im Sinn.

      • vietnamesische begleiterscheinung sagt:

        @ Brunhild Steiner

        ich kann dir leider wieder mal nicht antworten… irgendwie ist der blog hier kaputt. bei mir flimmert teilweise ein stück des blogs und plötzlich kann ich nicht mehr schreiben. irgendein firefox problem wohl.

        also was ich sagen möchte ist folgendes: du scheinst an jesus zu glauben. ich tue das nicht. jedenfalls nicht im biblischen sinne. ich möchte hier die diskussion darüber beenden, weil sie nirgens hinführen würde, da es letztlich um glauben geht und da kann man jedem den seinen lassen. auf einen gemeinsamen nennen kommt man nie. ist nicht bös gemeint, ich habe da nur schon genügend erfahrungen damit gesammelt. beste grüsse und bis ein andermal!

        @ redaktion

        kann es sein, dass der blog auf der aktuellen version von firefox auf mac nicht recht funktioniert? bitte überprüft das mal. bei mir flimmern teile des blogs und manchmal versagt die tastatur. und es liegt weder an meinem browser noch an meiner tastatur 🙂

      • vietnamesische begleiterscheinung sagt:

        @ Brunhild Steiner

        ich würde dir gerne antworten aber meine kommentare kommen nicht mehr durch. so ein ******-blog, das gibts doch nicht…

      • Brunhild Steiner sagt:

        @vietnamesische begleiterscheinung: hab teilweise ähnliche Probleme, manchmal dauert es Stunden bis der Kommentar dann steht. Dass wir nicht dasselbe Fundament haben ist offensichtlich, und klar hat das mit meinen persönlichen Glaubensüberzeugungen zu tun.
        Ich finde es spannend sich hier absatzweise vertiefter mit anderen Ansichten auseinandersetzen zu können, immer wieder die Möglichkeit sich neu zu überlegen, ob die individuell gemachten/getätigten „Auslegeordnungen“ für einen selber immer noch Bestand und Sinn machen, sich mit Fragen und Hinterfragungen konfrontieren die einem im persönlichen Umfeld vielleicht eher selten begegnen, von daher:
        merci fürs diskutieren und ebenfalls bis zum nächsten mal! 😉

    • Mike Shiva sagt:

      …oder einen Anruf bei mir. Kostet nicht viel und hat garantiert keine Warteschlaufe.

  • galactus sagt:

    In letzter Konsequenz muss den Kleinen vor allem beigebracht werden, dass absolut nichts gegen jedwelches Missachten von sogenannt humanistisch-ethischen Werten spricht. Das muss ihnen aber natürlich heimlich beigebracht werden. Am besten zwischen den Zeilen, ohne es auszusprechen, so dass sie selber draufkommen. Denn Heimlichkeit ist hierbei das oberste Gebot und wenn man von Menschen dabei nicht ertappt wird, dann von nichts und niemandem. Der öffentlichen Ordnung zuliebe müssen die Werte aber natürlich öffentlich hochgehalten werden.

  • Blitz Blank sagt:

    Ob die Religionen auf dem Vormarsch sind ist anzuzweifeln:

    „Nein, sagt hingegen der Franzose Olivier Roy, einer der derzeit interessantesten und profiliertesten Religionssoziologen, in seinem jüngsten Buch. Seine These: Die aufstrebenden religiösen Strömungen stellen nicht die Säkularisierung der Gesellschaft infrage. Im Gegenteil: Sie sind ihr Produkt. Im selben Masse, wie die hiesige gesellschaftliche Kultur ihre christliche Verankerung verliert, flüchten sich einzelne Individuen in die neuen religiösen Bewegungen.“

    Der ganze Artikel in der WOZ:

    http://www.woz.ch/artikel/rss/19894.html

  • Bruno Waldvogel-Frei sagt:

    Ich muss immer wieder schmunzeln. Zum einen hat der Grossteil der Bevölkerung kaum mehr eine Ahnung, wie eine inspirierende und lebendige Kirche funktionieren kann. Und dann sind sie völlig baff, wenn sie den Schritt bei uns mal über die Schwelle wagen. Vieles hätten sie erwartet. Aber der Faktor Gott überrumpelt sie dann doch etwas. Zum andern kommen selbst abgebrühte Agnostiker oft hilflos zu mir ins Büro, weil sie mit den ewigen alten einfachen und doch so schwierigen Fragen ihrer Kids (woher? warum?wozu?wohin?) oder schwierigen Lebenssituationen schlicht überfordert sind. Und ganz fasziniert beobachte ich immer wieder, wie der Glaube Menschenherzen, Beziehungen und Umstände oft ganz dramatisch zum Guten wendet. Und wie viel Taschentücher wir in unseren Glaubenskursen immer wieder brauchen, wenn aus der Erkenntnis ein Bekenntnis wird. Ich habe auch schon Vorlesungen an der Uni gehalten und die Wirtschaftsstudentinnen und Studenten waren genz verwirrt, als sie feststellen mussten, dass so vieles, das der „gesunde Menschenverstand“ zu wissen meint, in Wirklichkeit alte verschüttete christliche Werte sind. Selbst bei den neuen Atheisten wird es in Diskussionsrunden immer wieder peinlich still, wenn es um Begründungen des ethischen und moralischen Handelns geht. Spätestens bei der Kindererziehung. Wie es aussieht, wenn Gott abgeschafft und aus den Häusern und Schulen verbannt wird, durfte ich in den vergangenen Jahrzehnten eindrücklich in vielen Ländern vor Ort sehen und erleben. Um ehrlich zu sein: Nicht gerade beneidenswerte Orte. Tja, ich halte es mit dem guten alten Anselm von Canterbury, der sagte: „Credo, ut intelligam“ – ich glaube, damit ich erkennen kann. Und das ist wohl intellektuell auch am redlichsten. Wer’s glaubt,- Originalton Jesus – wird eben doch selig.

    • Globetrotterin sagt:

      Ja, ja. Selig sind, die Verfolgung leiden….

    • Blitz Blank sagt:

      Das tönt ja reichlich elitär und schadenfreudig.

      Wenn Sie Atheisten etc. als so schwach schätzen, dann sollten Sie bedenken, von welcher Potenz der „Droge Gott“ Sie als Gläubiger profitieren können: Jahrtausende des Glaubens und dessen Einübung.
      Die Menschenrechte hingegen sind erst mal ein paar Jahrzehnte alt und die basieren nicht auf metaphysischen Tamtam, sondern auf dem Wissen, um die Kreatürlichkeit des Menschen.
      Ich bin sehr optimistisch, dass sich die Menschen in 200 Jahren von ihren Göttern emanzipiert haben werden und diese Welt wird keine Welt ohne Werte sein, sondern eine bessere Welt.

      • Globetrotterin sagt:

        @Blitz Blank:
        Ihr Wort in „Gottes“ Ohr!

      • Blitz Blank sagt:

        Mir wär lieber:
        „Ihr Wort in der Meschen Ohr!“
        😉

      • StefanB sagt:

        Kreatürlichkeit? Sind Sie denn ein Kreationist, dass der Mensch kreiert worden ist?

      • Bruno Waldvogel-Frei sagt:

        Lieber Blitz Blank – ich will ja nicht elitär oder belehrend erscheinen – aber leider haben Sie sich wohl noch etwas wenig mit der Geschichte der Ethik und der Menschenrechte beschäftigt. Das metaphysische Tamtam ist der Ausschlag gewesen, dass jedem Menschen – auch dem Behinderten – eine besondere Würde zugestanden wird. Eben weil er von Gott geliebt und gewollt ist. Geben Sie mir ein einziges vernünftiges Argument, das ohne metaphysisches Tamtam auskommt, und das nicht in die Beliebigkeit der Werte führt. Ich bin sehr gespannt darauf 🙂 Die von Ihnen gelobten Menschenrechte basieren alle auf jüdisch-christlichen Werten. Auf keinem andern Boden konnten sie wachsen. Wenn Sie etwas gereist sind und die Kulturen der Welt studiert haben, wissen Sie das.

      • Globetrotterin sagt:

        @Waldvogel-Frei:
        Ihr Welt-Kulturstudium scheint ziemlich theologisch eingefärbt. Und: auch in vor-patriarchalen Zeiten gab es HochKULTUREN.

      • Blitz Blank sagt:

        @StefanB:

        Nein. Mit Kreatürlichkeit meine ich den Mensch als biologisches Lebewesen und seiner Fähigkeit u.a. Schmerz und Lust zu empfinden.

        @Bruno Waldvogel Frei:

        Wieso soll ich Sie vom Gegenteil überzeugen? Sie wissen anscheinend viel mehr als ich! Doch was wissen Sie über das Nichtwissen bzw. das Zweifeln?

      • Gianin May sagt:

        Eine bessere Welt? Wie denn? Ich sehe nichts, was mich zuverslichtlich machen würde, dass die Menschheit bereit wäre umzudenken resp. freiwillig auf etwas verzichten würde. Denn Verzicht, muss geübt werden und setzt voraus, dass man genug hat an dem was man hat, aber für einen solchen Wandel habe ich weder in der Vergangenheit einen Hinweis finden können noch ist da einer in Sicht; ausser es wird von gesetzes wegen durchgesetzt – erinnert mich immer an die Science-Fiction Filme der 80er Jahre – und diese zeigen keine bessere Welt.

      • Blitz Blank sagt:

        @Gianin May:

        Ich vertraue darauf, dass in 200 Jahren der Pragmatismus (bei Interesse Begriff googeln) der Menschen gesiegt haben wird.

  • the man sagt:

    Viele hier haben wohl aus persönlichen Motiven mühe mit der Kirche und allem was dazu gehört. Wichtig scheint mir aber die Unterscheidung zwischen Kirche (Institution) und Religion (Inhalte), und ein objektiver Umgang mit diesen Themen.
    Um die Diskussion zu versachlichen ein anderes Beispiel:
    In meiner Schulzeit musste ich mich ausgiebig mit griechischer Mythologie beschäftigen (also Religionsunterricht über die Antike), mit der Begründung, viele Werke der modernen Literatur seien ohne dieses Wissen nicht zu verstehen. Und genau darum geht es. Ohne ein umfassendes Basiswissen über christlich-jüdische Inhalte wird man den Grossteil der klassischen Literatur nicht verstehen.
    Es versteht sich von selbst dass in einem solchen Fach auch Platz für agnostische und philosophische Ansätze sein muss damit auch eine inhaltliche Auseinandersetzung mit religiösen Fragen möglich ist und man nicht auf dem Niveau „Islam ist böse“, „Katholiken sind gegen Sex“ und „Ich muss nicht glauben, ich kann denken“ bleibt…

  • Tja, liebe Frau Binswanger, da verweigert man die Konfirmation und dann … siehe an, der Sohn kommt mit der Wette von Pascal. Hehe. Es soll Ihnen nicht besser gehen. Als mein Professor mich auf ein hochkomplexes Thema ansetzte, wo die marxistische Geschichtstheorie mit Pauken und Trompeten scheiterte, kam ich nach langem Forschen und Grübeln dahinter, dass der philosopische Materialismus scheitert, weil er platte, flache Begriffe hat. Sein Scheitern beobachtete ich schon in der Philosophie. Als „Atom- und Waldsterbensensibilisierter“ warf ich mich in die „philosophische Ethik“ … aber bald nahm ich Abstand davon, denn es blieb alles eitles Geschwätz. Seither bin ich überzeugt, dass ohne Sinai eine Ethik nicht zu haben ist. Ich bin ein grosser Sünder und lebe allein aus der Gnade. Keine Revolution hat je die Wirkung dieses Satzes gehabt, aber jede Revolution rekuriert auf diesen Urgrund. Ich hatte mich auch schon abgefunden mit der Unbeweisbarkeit Gottes als meine Tochter einmal mich den Historiker fragte: „Papi, wann hört das Zählen auf“ – „Hmm, das Zählen hört nie auf, denn es ist immer eine noch grössere Zahl denkbar.“ – „Hmm, das muss aber kluger Mensch gewesen sein, der als erster das Zählen erfunden hat.“ – „Ja, aber eigentlich ist das Zählen etwas Natürliches, es liegt in der Hand, man beginnt mit den Fingern, nimmt die Zehen dazu und dann noch tinger und Zehen eines anderen Menschen…“ – „Und das hört nie auf?“ – „Genau, das kann bis ins Unendliche fortgesetzt werden …“ längere Paus „Papi, dann kann das Zählen gar nicht von den Menschen sein, dann muss es von Gott kommen!“ Die klare Evidenz dieses Gedankens überzeugte mich, wenn auch in den Philosophischen Lehrbüchern – ich weiss – irgend ein geistiger Flachmaler „bewiesen“ hat, dass des keine philosophischen Gottesbeweise geben kann. Der Mensch ist ein kochendes und gottkrankes Tier. Das wird er immer bleiben. Und darum muss in der Schule vom Berg Sinai die Redes sein, von Moses Auszug aus Ägypten, denn nur wer den „Auszug aus Ägypten“ verstanden hat, wird den „Auszug aus der selbstverschuldeten Unmündigkeit“ der Aufklärung verstehen.
    Die grössten, hellsten und tiefsten Aufklärer waren jene, die Gott im Spiel liessen. Selbst Voltaire soll einmal bei einem Leichenzug den Hut gezogen haren. „Sie glauben doch nicht etwa an Gott!“ fragte sein Begleiter: „Sagen wir es so: wir sprechen nicht mehr miteinander, aber wir grüssen uns noch“ antwortete Voltaire.

    „Es spricht der Narr in seinem Herzen: es gibt keinen Gott“ steht in der Bibel. Ja, ein grosses Wort. Auch der Atheist Gottried Keller kämpfte nach 1870 für die Religion. In der Novelle „Das verlorene Lachen“ (1874) und in seinem grossen Einsatz für das Fach „Biblische Geschichte“. Eine Schule ohne Gott ist eine Narretei. Und es gibt nichts Dümmeres unter der Sonne als die Überheblichkeit „vernunftbesoffener“, exhibitionistischer Atheisten. Wem die Gnade des Gottvertrauens versagt ist, der behalte diesen Makel für sich, und rühme sich nicht seiner scheinbaren Abgeklärtheit. Meist sind es geltungssüchtige Dummköpfe ohne Kinder. Denn vielfach schenken uns erst unsere Kinder wieder die Demut, Gott einen Platz im Herzen zu schaffen.

    • Globetrotterin sagt:

      @G.G.:
      Wenn ich nicht schon Agnostikerin wäre, hätte mich spätestens dieser Kommentar zu einer solchen werden lassen.

      • Dann war der Kommentar sehr nützlich, er hat die Linien klart gezogen. Wie gesagt, wenn Sie aus dem gröbsten raus sind nach dem Kindbett, und das Ocytozin Ihr vernunftgetränktes Hirn durchflutet hat, lade ich Sie gerne zu einem Kaffe ein. Vorher hat es keinen Sinn. Immerhin nennen Sie sich Agnostikerin: das gefällt mir. Auf den Keks gehen mir nur die exhibitionistischen Atheisten.

      • Orlando S. sagt:

        @Globetrottrin: Wenn sie sich nicht schon längst selber disqualifiziert hätten, wäre das spätestens mit diesem Kommentar geschehen, meine Liebe.

      • fufi sagt:

        So viel gelernt.
        Und NICHTS verstanden!

      • Globetrotterin sagt:

        Das kommt wohl daher, dass ich gebetet habe:
        Lieber Gott, mach mich blind
        damit ich diese Männer herrlich find
        Und mach mich obendrein noch dumm
        damit ich um den Frust rum kumm.

      • fufi sagt:

        @Globe

        Soweit du in deinem Gebet
        „Diese“ und nicht „alle“ Männer
        meinen magst:
        AMEN!

    • Logine sagt:

      Pascals Wette ist ein plumper Versuch, einen dümmlichen „Gott“ übers Ohr zu hauen. Da halte ich’s lieber mit W. Allen, der davon ausgeht, dass der Allmächtige, so es ihn gäbe, mehr Freude an seiner ehrlichen Opposition als seinen opportunistischen Mitläufern hätte.

      • Genau: Darum bin ich auch „Protestant“ nie Mitläufer, immer in der Opposition. Aber auch mit einem Herz für eine Logine (die sich auf den LOGOS beziehen will?). Bleiben Sie ruhig im der Mitte des breiten atheistischen Mainstreams, das ist die derzeit angesagte „intellektuelle Position“, Logine, und lassen Sie sich nicht durch Einwände beunruhigen.

    • Cara Mia sagt:

      Die Erkenntnis, dass der philosophische Materialismus scheitern muss, bedingt nicht, dass man an einen Gott glaubt. Das ist der Denkfehler, den Girardet hier macht. Er flüchtet vor dem Nichtwissen in ein Scheinwissen, den Glauben an Gott, wie so viele. Eine reine Angstreaktion. Stark ist nur, wer erkennt, dass er nichts wissen kann, und dies akzeptiert.

      • Ja, wieder die Feministin vom Rheinknie. Natürlich muss de Girardet ein Angsthase sein, schon klar, und wer sich „Cara Mia“ nennt, hat nicht nur die grosse Empathie (haben nur Frauen!) das zu merken sondern auch das grosse Herz dieses Problem aufs Tapet zu bringen. Ich bin ein armer Pinsel, unbestirtten. Der Fritzli Dürrenmatt hat es für mich aber auf den Punkt gebracht: „Der Wissende weiss, dass er glauben muss“. Prägnanter geht es nicht. Wer zu wissen glaubt, nicht glauben zu müssen, ist eben ein Dummkopf. Schon die schlichte Mathematik setzt den „Glauben“ an dei Zahl „1“ und an „Unendlich“ voraus. Ohne diesne „Glauben“ an Axione, die unverfügbar bleiben, gibt es weder Mathematik noch Buchhaltung.

    • Globetrotterin sagt:

      Orlando kann’s nicht lassen! Von „Meine Liebe“ scheint er genauso fasziniert zu sein wie von der Anthropologie!

    • Katharina sagt:

      Giorgio fordert das gleiche wie die Talibanski. einfach mit einem anderen vorgeschobenen ‚Wertesystem‘. Calvin bei Null Grad Kelvin.

      „denn nur wer den “Auszug aus Ägypten” verstanden hat, wird den “Auszug aus der selbstverschuldeten Unmündigkeit” der Aufklärung verstehen. das ist eine Interpretation.

      Vor allem ist dann da eine unglaubliche Frechheit, von selbst verschuldeter Unmündigkeit zu reden. So was hat einen PhD in Geschichte?

      und dann lustig, weil der Herr die ach so christlichen wurzeln Europas beschwört und dann als Beweis eine jüdische Tradition nimmt. Römer und Mauren bleiben aussen vor.

      Ha!

      wie ist das eigentlich: ist der Gottfried Keller so ne art Initiationslektüre. so etwa dann beim schwülstigen schmachten Rübe tunken? muss ne neue Droge sein oder so.

      • Orlando S. sagt:

        schon Mal etwas von Kant gehört, Herzchen?

      • Katharina sagt:

        wieso?

      • Orlando S. sagt:

        mich dünkt sie haben das mit der selbst verschuldeten Unmündigkeit ehm nicht verstanden. Googeln sie nach dem Lichte!

      • Orlando S. sagt:

        mich dünkt sie haben das mit der selbst verschuldeten Unmündigkeit ehm nicht verstanden. Googeln sie nach dem Lichte und lassen sie sich erleuchten!

      • Katharina sagt:

        Sie können es mir ja hier erklären, O. Eine kleine Lektion in Kant und wie er mit dem Thema zusammenhängen soll. Wäre doch besser als eine herablassende Bemerkung darüber, dass ich wohl nicht ein wandelndes Philosophielexikon bin. Auch andere können dabei etwas lernen.

        Sie finden also, Sie seien erleuchtet?

        Ich masse mir so was nicht an, irgendein gottähnliches Wesen zu sein.

  • Brian sagt:

    „Gründen letztlich nicht auch humanistisch-ethische Werte auf einem aufgeklärten Glauben?“
    Das ist eine ziemlich verdrehte Wahrnehmung. Der „aufgeklärte Glaube“ ist das Ergebnis einer humanistischen Aufklärung, nicht deren Ursprung.
    Solche Aussagen zeugen von einem sehr lückenhaften Geschichtsverständnis und passen zu der Weltanschauung, in der man sich selektiv ein wenig von allem zusammenstellt. Nicht nur, aber gerade wenn es um Religion geht.

  • Daniel Bloch sagt:

    Danke für den Artikel, besonders über den Teil der Wurzeln. Bevor sich hier einzelne zu weit aus dem Fenster lehnen, sei das Buch „Ohne Wurzeln“, ein Dialog zwischen Joseph Ratzinger (als er noch nicht Papst war) und Marcello Pera, Freidenker, bekendender Atheist, Agnostiker und (ehem?) Präsident des ital. Senats.

    Zitat von Pera
    „Im Grunde sind wir alle Christen, und ohne christlichen Glauben ist in Europa kein Staat zu machen! Wenn Europa seine christlichen Wurzeln verleugnet, verliert es seine Identität und verschwindet aus der Weltgeschichte,“

    Dem habe ich nichts hinzuzufügen.

    Liebe Grüsse
    Daniel

    • Logine sagt:

      Bin nicht ganz einverstanden. Gemäss Luis Bunel sind wir ja alles Katholiken:
      http://www.youtube.com/watch?v=B9lvGF3kn98

      Dass Europa christliche „Wurzeln“ – neben anderen, notabene – hat bezweifelt nicht mal ein „Freidenker“. Der Baum besteht auch nicht nicht bloss aus Wurzeln. Die Neuzeit gehört genauso zur Geschichte wie das Mittelalter, im Englischen treffender mit „dark ages“ bezeichne.

      Obwohl wir heute vielleicht auch keine ipods hätten, wäre nicht mal einer auf die Idee des Grammophons gekommen, wird wohl kein Musikliebhaber Beethovens 9. darauf abspielen.

      • Orlando S. sagt:

        Hätte Beethooven nicht seine 9. geschrieben, und wäre später einer auf den Gedanken gekommen, ein Grammophon zu bauen, damit man Beethovens Musik damit zuhause anhören kann, dann hätten wir heute keine iPods – das ist die korrekte Kausalfolge!

        Ich höre übrigens laufend Beethoven auf meinem iPod und sogar Bach, huch, der ist ja noch älter!

  • Astrid sagt:

    Unsere Kinder, in London geboren, wo das durchaus üblich ist, wurden nicht getauft. Als wir in die Schweiz kamen, haben wir Wert darauf gelegt, dass sie in den Unti gehen – wofür wir nicht wieder in die Kirche eintreten mussten, man hat uns ganz pragmatisch Einzahlungsscheine präsentiert. Sie sind kritische Geister geworden, die ohne unseren Einfluss den Kopf schüttelten, als ihre Gspänli hauptsächlich des Geldes wegen die Konf mitmachten, dann aber die Kirche links liegen liessen.
    In unserem Dorf, in dem unsere Kinder mit Freikirchlern/Bruderschaftlern etc aufwuchsen und in die Schule gingen, mussten wir uns oft rechtfertigen, können aber jetzt mit Freude sagen, dass sie zu anständigen, liebevollen und kritischen Frauen geworden sind. Unser Motiv, dass Information richtig, Indoktrination aber falsch ist, hat sich bewährt.

  • stöcklin sagt:

    und wer nicht an jesus glaubt kommt in die hölle ? das sind die werte ?
    merkwürdige liebeszwang um in den himmel zu kommen . die werte müssen die eltern vermitteln !

    • Benjamin Hitz sagt:

      Ich bin zwar auch Agnostiker, aber ich weiss immerhin so viel von dem christlichen Glauben, dass ich das Gleichnis des Samariters kenne und somit auch weiss, dass nach Jesus‘ Ansicht durchaus nicht in der Hölle landen muss, wer nicht an Jesus glaubt.
      Der christliche Glaube ist NICHT die katholische Kirche, nicht die evangelische und nicht all die evangelikalen. Der christliche Glaube soltte ja eigentlich sein, dass der Mensch ein Leben führt, in dem er sich an Jesus und seinen Worten misst. Würde er das tun, dann würde er übrigens auch nicht, wie ein anderer Schreiber oben erwähnte, einen Giordano Bruno in den Kerkern foltern.
      Ich finde durchaus, dass diese religiösen Grundlagen, die nebst anderen zu den Grundlagen unserer Zivilisation gehören, in der Schule gelehrt werden sollen und dürfen. Es ist eben nicht so, dass alle Kulturen relativ zueinander stehen und irgendwie gleichartig oder -wertig sind. Unsere Kultur hat sich aus bestimmten Einflüssen heraus entwickelt und wenn wir ihre Freiheiten annehmen und geniessen, dann sollen wir auch wissen, woher diese Freiheiten kommen, woraus, worüber, wodurch und auch wogegen sie sich entwickelt haben.

      • Gänzlich einverstanden.

      • StefanB sagt:

        Ach Gott, Giordano Bruno wurde nicht wegen seines Glaubens gefoltert, sondern weil er aufgrund seines Glaubens die weltlichen und religiösen Machtstrukturen bekämpfte und wegen seines Zulaufes die damaligen Mächtigen bedrohte.

        Interessant ist dabei, dass ein ebenso radikaler Querdenker wie Franz von Assisi zwar scharf beobachtet, aber weder als Ketzer verbrannt wurde noch seinen Überzeugungen abschwören musste: er wurde ziemlich rasch als Heiliger verehrt.

      • Benjamin Hitz sagt:

        @Stefan B: Ich stimme ihnen zu. Dass Bruno wegen seines Glaubens verfolgt worden wäre, habe ich übrigens nicht behauptet, sondern Logine hat weiter oben implizite Behauptung aufgestellt, dass Brunos Folterungen etwas mit der (christlichen) Religion zu tun gehabt hätten, was so einfach nicht stimmt, wie sie ja dankenswerterweise darlegen.

      • mila sagt:

        nun, giordano bruno wurde von der kirche als ketzer betrachtet, da er sich unter anderem von der trinitätslehre abgewandt hatte. das ist – zumindest aus sicht der kirche – ein starkes religiöses verfolgungsargument, nebst den erwähnten sozialen.

  • Ich kenne kaum einen Freidenker, der findet, Religionskunde hätte in der Schule überhaupt keine Platz verdient. Ein eigenes Fach bräuchte es dazu allerdings nicht zwingend. Dies doch so vorzusehen, war eine etwas ängstliche Reaktion des Zürcher Kantonsrates auf die Volksinitiative evangelikaler Kreise, welche den Bibelunterricht, den der Kanton nicht mehr mit zahlen wollte, hätte retten sollen. Das Parlament gelobte also etwas besseres in den Lehrplan aufzunehmen und so wurde das Fach «Religion & Kultur» erschaffen…

    Die politische Ausgangslage akzeptieren die Freidenker sehr wohl. Sie bestehen aber ebenso darauf, dass Artikel 15 der Bundesverfassung eingehalten wird, der besagt «Niemand darf gezwungen werden … religiösem Unterricht zu folgen.» Die Bildungsdirektion nimmt jedoch mutwillig Kurs auf den Eisberg. Was im Fach R & K geboten wird, ist eine reine Angebotspalette der Religionen, alles weltliche wird aussen vor gelassen. So entsteht vor allem auf den unteren Stufen für die Kinder ein impliziter Druck, aus dieser Angebotspalette etwas anzunehmen, Kinder aus nicht religiösen Haushalten werden nicht abgeholt, das Fach tut so, als ob es sie schlicht nicht gäbe, es wird nichts aus ihrem Alltag berichtet. Damit verkommt das Fach eben doch zu «religiösem Unterricht», den die Bundesverfassung ausschliesst. Das Fach ist aber in der aktuellen Form nicht nur für Kinder und säkular eingestellten Eltern eine Zumutung, es ist es auch für Lehrpersonen. Es wäre billig, beim Hombrechtiker Fall die Schuld alleine der Lehrperson in die Schuhe zu schieben, die einen gänzlich ungeeigneten Text erwischt hat. Das Fach gehört inzwischen in allen Gemeinden zum Stundenplan, es gibt aber noch kein Lehrmittel und die Lehrpersonen werden ungenügend über zwingende Spielregeln instruiert.

    Eine Evaluation des Fachs brachte erste, äusserst ernüchternde Ergebnisse zu Tage: Keine der Lehrpersonen, die früher biblische Geschichte unterrichtet hatte, hatte wirklich verstanden, dass das Fach ganz anderen Rahmenbedingungen gerecht werden müsste. Und jede zweite Lehrperson verwendet Elemente des «teaching in religion», also des Unterrichtens aus einer bestimmten religiösen Warte heraus, statt konsequent Religionskunde (neudeutsch: teaching about religion) zu betreiben. Der zuständige Bildungsrat Jürgen Oelkers sieht aber keinerlei Handlungsbedarf. Er ist es auch, der durchsetzen will, dass der Kanton Zürich beim überkantonalen Lehrplan 21 eine Ausnahmeregelung erhält: Oelkers sträubt sich dagegen, dass Zürcher Schüler Lehrziele zum Thema Ethik vorgegeben kriegen, Religion soll ihnen genügen. (Der Titel des Fachs ist eine Mogelpackung, Kultur kommt nur in religiösem Korsett daher.)

    Dass mit diesem Fach schulische Selektion betrieben wird (es ist ein Notenfach und hat den Status «provisorisch obligatorisch») ist ein Skandal, ebenso dass der Kanton mutwillig Dutzende von Millionen in den Sand setzt. Denn es ist klar, dass das Fach in der heutigen Form vor Bundesgericht keine Chance hat.

    Es geht übrigens sehr wohl auch anders: Der Kanton Graubünden ist dabei, ein zukunftsfähiges Modell zu entwerfen, bei dem in der Volksschule neu eine Lektion pro Woche Ethik und Religionskunde unterrichtet wird, und der (freiwillige) kirchliche Konfessionsunterricht sich in Abstimmung mit dem Lehrplan mehr auf die eigenen kultischen Inhalte konzentrieren kann. Die Ausgestaltung in Graubünden geschieht übrigens unter Federführung der Ethikfachstelle der Uni Zürich. Zum Zürcher Fach «Religion & Kultur» müssen sie aber aussen vor bleiben.

    • StefanB sagt:

      Kinder aus nicht religiösen Haushalten werden nicht abgeholt, das Fach tut so, als ob es sie schlicht nicht gäbe, es wird nichts aus ihrem Alltag berichtet.

      Naja, das liegt wohl einfach daran, dass nicht-religiöse Menschen schlicht keine spezifische Riten kennen, im Gegensatz zu zum Beispiel Katholiken mit Prozessionen und Heiligenverehrung oder Moslems mit den fünf täglichen Gebeten.

      Was das Fach angeht, so wäre mein Vorschlag, dass der Besuch obligatorisch und es auch Noten geben, aber nicht zur Selektion beitragen sollte. Eine salominische Lösung – wobei man diesen Ausdruck nur versteht, wenn man die Geschichte(n) dahinter kennt. Wobei Salomon im AT durchaus kontrovers dargestellt wird (als „Lichtgestalt“ wie auch als Despot…).

    • Globetrotterin sagt:

      „Nichts ist entlarvender und auf die Dauer nervender als lärmende Dummköpfe.“ – RICHTIG, GG! Halten Sie sich an Ihre eigenen Thesen!

    • Verräterisch ist die Passage „Die Ausgestaltung in Graubünden geschieht übrigens unter Federführung der Ethikfachstelle der Uni Zürich. Zum Zürcher Fach «Religion & Kultur» müssen sie aber aussen vor bleiben.“ Es geht also darum, dass der Staat, der schon ein theologische Fakultät und Lehrstühle in Religionsgeschichte berappt nochmals eine kuschelige Nische für Schwätzer schaft: eine „Ethikfachstelle“. Das Muster kennen wir mittlerweile: die Feministinnen verlangten „Gleichstellungsbüros“, die Freidenker „Ethikfachstellen“: irgendwo müssen ja die Dummköpfe, die man als treues Stimmvieh braucht auf dem Weg an die Hebel der Macht ja dann ihren Arbeitszeit absitzen können bevor sie pensioniert werden.

  • Religionsunterricht in der Schule soll nicht sein. Wir haben es mit der Säkularisierung weit gebracht und sind damit gut gefahren. Der Gottesglaube wird durch Prägung eingeimpft und ist Sache der Eltern und nicht des Staates. Die Frage ist folgende: Ist ein Gläubiger in seinem Leben glücklicher als ein Ungläubiger? Gottesglaube ist ein Placeboeffekt und hat Vor- und Nachteile, besonders wenn der Sündbegriff noch mitspielt.

  • Oliver sagt:

    Hallo??? Die wichgtigste Frage bleibt offen…. lief der Film auf dem Computer? 🙂

  • Logine sagt:

    Märchenstunde light. Nach dem Motto: Nützt’s nüüt, so schadt’s nüt. Big mistake. Man öffnet den eigentlich von Natur aus sehr pragmatischen Kindern eine Grauzone, in der sie anfällig werden für Heilsversprechungen jeder Art. Von der Astrologie bis hin zu den wüstesten Verschwörungstheorien.
    Nichts gegen Religionsunterricht. Aber bitte nicht in der Schule, in der die Kinder davon ausgehen dass das, was der Lehrer erzählt, manchmal zwar schwer zu verstehen ist wie zBsp. Algebra, aber „verhebbt“ und stimmt.

    Den Kulturrelativismus führen wir indessen ja erst dadurch ein, dass zBsp. die bis anhin UNIVERSELLEN Menschenrechte aufgrund religiöser Befindlichkeiten unterwandert werden.

    Apropos Humanismus nährt sich von REligion. Vielleicht fragt man mal bei Giordano Bruno nach, wieviel „Humanismus“ man ihm in päpstlichen Kerkern angedeihen liess.

    • the man sagt:

      … wie wenn es ohne religiöse Werte überhaupt Menschenrechte gäbe! By the way: Hast du dir schon mal überlegt, dass die Aufklärung und die mit ihr einhergehenden „-ismen“ (Nationalismus, Sozialismus, Liberalismus…) mehr Leid über die Welt gebracht haben als alle Religionen zusammen?!?

      • Marc sagt:

        @the man Naja da kann ich ihnen nicht zustimmen. Mehr Leid als was? Die Kreuzüge die unzählige Tote kostet auf geheiss der Religion! oder die vielen Denker aus dem Mittelalter die alle wegen Kezerei getötet und Mundtot gemacht wurden? Ich denke nicht. Mit den meisten Religion kann ich mich Indetifizieren aus dem Grund das das Gedankengut nicht nur veraltet sondern vorallem sehr Scheinheilig ist.

      • Urs68 sagt:

        …..äh, welches unermessliche Leid genau hat der Liberalismus über die Menschheit gebracht?

        Die Erklärung der Menschenrechte? Die Bill of Rights? die Declaration of Independance? die Amendments zur US-Constitution?

        Hitler liess sich übrigens als von „der Vorsehung“ auserwählter Führer feiern, blieb Zeit seines Lebens Katholik und glaubte auch in den letzten Stunden im Führerbunker noch an ein Wunder von oben. Er liess Goebbels im Sportpalast fragen: „Wollt Ihr in diesen totalen Krieg gehen wie in einen Gottesdienst?“, worauf Tausende mit „Ja“ und „Heil“ antworteten. Auf der Koppel jedes deutschen Soldaten vom Atlantik bis vor Stalingrad stand „Gott mit Uns“. In Nürnberg sagte er zum Deutschen Volk „Dass ich Euch gefunden habe, und dass ihr mich gefunden habt, das ist kein Zufall“. Stalin wollte ursprünglich Priester werden.

      • the man sagt:

        Auch wenn historische Vergleiche wenig sinnvoll sind, so sind doch während der Kreuzzüge (die kaum religiöse sondern vielmehr machtpolitische Hintergründe haben) viel weniger Menschen getötet worden als z.B. in russischen Gulags. Dass auch der Liberalismus unzählige Menschenleben in den Fabriken, Bergwerken und Kolonien gefordert hat dürfte klar sein. Und zu Hitler oder Stalin: nur weil sich jemand auch Gott beruft hat das noch lange nichts mit Religion zu tun. Auch in Nordirland geht es um Macht und Nationalismus, nicht um Glauben…

      • Brunhild Steiner sagt:

        @Urs68: um das Bild zu vervollständigen, Hitler hat die Bekennde Kirche mit allen Mitteln bekämpft!
        Und nach erfolgreichen Vernichtung der Juden wären als nächstes alle „im echten Sinne“ bekennende Christen drangewesen…

      • Benjamin Hitz sagt:

        Dass Hitler Zeit seines Lebens Katholik geblieben wäre (auf der Handlungsebene), ist eine recht kühne Behauptung. Nur weil die katholische Kirche der damaligen Zeit sich in Komplizenschaft übte (wobei dies durchaus nicht alle ihre Vertreter taten), heisst das noch lange nicht, dass man einen Hitler reinen Gewissens noch als Katholiken bezeichnen könnte.

      • Sama M. sagt:

        War zuerst das Huhn oder das Ei? Natürlich würde es ohne Religion auch Menschenrechte geben. Die Ideen der 10 Gebote mussten ja bei den Menschen im Umlauf gewesen sein, sonst hätte man sie nicht in Stein gemeiselt. Religion war vielleicht ein Zugpferd, aber nicht die Ursache für aufkeimenden Huamnismus.

      • Marc Meier sagt:

        Im Namen der religiösen „-ismen“ wurde schon weit vor der Aufklärung (und seither fast ungebremst weiter) schlimmstes getan: Menschenopfer in der Antike, Folterungen seit der Antike bis in die heutige Zeit, Versklavungen, Verfolgungen, Unterdrückung und so weiter und so fort. Das setzt sich bis in die heutige Zeit fort, in der zum Schutz der lokal vorherrschenden Religion Verbrechen an Einzelnen oder Massen gedeckt und vertuscht werden. Immer im Namen irgend eines Gottes, dem man angeblich dient oder irgend welcher religiösen Werte… Religion gehört in die eigenen vier Wände. Die Schule soll lehren, nicht Dogmen verbreiten. Ausserdem ist Erziehung und Wertevermittlung Familen/Privatsache und nicht Aufgabe der Lehrer oder der Schule.

  • O. Omlin sagt:

    Ich bin aus der Kirche ausgetreten und glaube auch nicht an die Gott-Geschichten.

    Aber meine Kinder sind noch drin und sollen auch mit den Werten und Traditionen aufwachsen. Einfach auch darum, damit sie einen vernünftigen Umgang mit Religion lernen und nicht in Sekten wie ICF oder so abschlittern.

    • Aloho sagt:

      Ich bin aus der Kirche ausgetreten und meine Tochter ist NICHT drin. Trotzdem haben wir in der Adventszeit eine Kirche angeschaut und ich habe ihr die Krippe erklärt, bzw. die Geschichte erzählt. Sie wird, wenn sie Lust hat, mit ihrer religiösen Grossmutter eines Tages die Messe besuchen und wir werden darüber reden, dass die Grossmutter gläubig ist und ich und Papi nicht. Um in eine Sekte abzurutschen braucht es nicht Unreligiösität, sonder einen unrkritischen Geist. Wir können nur Hand bieten zu einer offenen und kritischen Diskusion. Um mit Werten und Traditionen aufzuwachsen bringt es nichts, Kinder in der Kirche zu lassen und selber auszutreten. Werte und Traditionen müssen in der Familie gelebt werden, das geht auch ohne Glauben.

      • Wegen solchen geizigen Dummköpfen werden die Landeskirchen bald Eintrittsgelder in der Adventszeit verlangen müssen. Eine solche Haltung hat mit „philosophischer Ethik“ gar nichts mehr zu tun sondern viel mit: Geiz, Engherzigkeit, Eitelkeit, Trittbrettfahrerei und Dummheit zu tun. Deine Handlungsweise hält dem kantischen Imperativ nicht stand. Es wäre philosophisch redlciher der Kirche beizutreten, und den Kindern zu sagen: ja ich trage das mit, auch wenn ich nicht daran glauben kann, statt den Kindern zu sagen: „Ich bin viel intelligenter, aber im Advent, wenn es um Kuscheln geht, dann gehen wir zu den Dummen und Gemütlichen“

      • Aloho sagt:

        Die Kirchen wurden mit unser allen Steuergelder finanziert (Staat, Firmenkirchensteuer…) und gehören zu unserem Kulturgut und zu unserem Stadt- und Dorfbild. Die Kirchenglocken läuten und wir müssen / dürfen sie alle hören, da finde ich, darf ich meiner Tochter auch erklären, was das ist und welche Geschichte dazu gehört. Ich tue das weder abschätzig noch wertend, ich erkläre einfach, wie verschieden die Menschen sind und dass es nichts mit unserer Liebe zu tun hat. Ich liebe meine katholische Mutter und ich liebe meinen atheistischen Mann. Und meine Tochter hat das Recht, das alles zu wissen.

      • Benjamin Hitz sagt:

        Mit Verlaub: Wenn sie aus der Kirche ausgetreten sind, dann bezahlen sie auch keine Kirchensteuer mehr und gehören somit auch nicht mehr zu denen, die die Kirche finanzieren. Das will ich gar nicht verurteilen, denn sie haben jegliches Recht zu dieser Handlung, aber Herr Girardet hat schon Recht damit, dass ihr Anspruch auf die kirchliche Adventskuscheligkeit damit eigentlich verfallen wäre (zumindest im kirchlichen Sinne, von einem rein christlichen Aspekt aus könnte man darüber diskutieren).

      • André sagt:

        @B. Hitz
        Mit Verlaub: Jeder Bürger zahlt indirekt durch die Firmenkirchensteuer Geld an diese Vereine.

      • Benjamin Hitz sagt:

        @André: Mit Verlaub, da haben sie recht, das habe ich nicht bedacht. Ich ziehe also das Adventskuschelverbot wieder zurück. Die Kirchen sind per Dekret wieder offen für alle, die sie als Lifestyle-Angebot betrachten! Hurra!

      • fufi sagt:

        Kirchen (und dazugehörige Menschen) sind nicht „per Dekret“ offen für alle Menschen, sondern aufgrund ihres Glaubens.
        Und wenn’s denn Kirchen und Menschen geben sollte, die aufgrund ihres Glaubens NICHT für alle Menschen offen wären, tja, DANN würde ich „Kirche“ und „Glaube in „“ setzen!
        🙁

    • chr sagt:

      Ich bin nicht gläubig, aber in der Kirche als soziale Institution. Auch finde ich, dass ich den Religionsunterricht meiner Kinder durchaus mit meiner Kirchensteuer zahlen soll und nicht andere dafür aufkommen sollen. also, wenn die Kinder in den Unti, dann bitte auch Kirchensteuer zahlen.
      Für meine Kinder: Unterricht bis Konf-Unti Pflicht, Konfirmation aber nicht. Dann wenn sie diese religiöse Ausbildung haben können sie wirklich frei entscheiden. Das Wissen über die abendländische Kultur sollten sie haben, um werten zu können. Werten im Sinn von Vergleichen, nicht Anderes abwerten.

      • Diese Haltung scheint mir wirklich „aufgeklärt“. Man muss den Kindern die Tools in die Hand geben, sie können mit 16 entscheiden, will ich auch ein Einzahlungsscheinchrist werden wie meine Eltern, ein „christliches Leben“ führen, oder Konfirmation verweigern und Austreten. Aber die Kirche hat das Geld bekommen um Räume, Lehrkräfte und Theologen zu bezahlen.

    • Spoony sagt:

      Ui! Ich muss feststellen, dass da jemand den Mund weit aufreisst und von Sekten und anderen Glaubensgruppen KEINE Ahnung hat. Wie tief wollen Sie, O.Omlin, noch fallen?

      • Adrian sagt:

        Nun, die Freikirchen à la ICF sind nunmal sehr doktrinär. Dort werden Geschichten als wahr verkauft, welche sich historisch und wissenschaftlich widerlegen lassen (und das ist bei Glaubensinhalten durchaus kein einfaches unterfangen – schon klar!).
        ich glaube Gott hat im Schulzimmer nichts verloren, zeichnet sich eine säkulare Gesellschaft nicht gerade dadurch aus, dass die Kultausübung aus dem öffentlichen Raum zurückgedrängt wurde?

      • O. Omlin sagt:

        viel weiter als auf den Boden kann man nicht fallen. Und wenn man aufstehen kann, steht man mit beiden Füssen fest drauf.

Die Redaktion behält sich vor, Kommentare nicht zu publizieren. Dies gilt insbesondere für ehrverletzende, rassistische, unsachliche, themenfremde Kommentare oder solche in Mundart oder Fremdsprachen. Kommentare mit Fantasienamen oder mit ganz offensichtlich falschen Namen werden ebenfalls nicht veröffentlicht. Über die Entscheide der Redaktion wird keine Korrespondenz geführt.